MegaSitio Artículos de Interés MegaSitio Autos MegaSitio Belleza MegaSitio Dietas MegaSitio Recetas MegaSitio Mujer MegaSitio Entretenimientos
Noticias en MegaSitio
Videos en MegaSitio
Enlaces Sugeridos
Temas de Interés


 

John Cena


Publicada en : 2007-04-28 en la categoria: Actores
  

La superestrella de la WWE, actor y músico, John Cena es una de las jóvenes estrellas emergentes de hoy en día.

Conectado al cien por cien con la cultura moderna de hoy en día, ha logrado reunir un significativo número de fans en los últimos tres años.

Emplea su carisma, su ética estajanovista de trabajo y su pasión para ofrecer a sus seguidores una descarga de auténtica adrenalina cada vez que sube al cuadrilátero.

De raíces modestas y con una fuerte y marcada personalidad, conecta con fans de todo el mundo de una forma genuina al alcance de muy pocas celebridades.

La intensidad y la autenticidad de John Cena le han hecho un nombre familiar dentro de los deportes de entretenimiento y la superestrella más popular de la WWE, tanto en atractivo para los fans como en venta de productos.

Desde que debutara allá por el mes de junio de 2002, John se ha convertido en dos veces campeón imbatido del Campeonato de los Estados Unidos en “WrestleMania”.

La venta de los productos relacionados con él ha superado los doce millones de dólares en 2004.

En la actualidad, se le puede ver todas las semanas en más de cien países, además de actuar anualmente en doscientos espectáculos en directo en los cinco continentes.

Más adolescentes siguen a John Cena cada semana que los que ven un partido de la liga regular de la NFL, la NBA o la MLB.



Comentarios(1004)

manuelle escribió:
john cina eres lo mejor de la wwe ...
Fecha: 2007-05-16 21:04:50
 

claudia diaz escribió:
hola soy fanatica de john cena es mi luchador favorito quiero sabre si me puedo poner en contacto con john el me puede escribir a mi correo soy de Guatemala espero tu mail bye.
Fecha: 2007-05-10 13:32:07
 

carlos escribió:
johh cena eres verdaderamente ridiculo e imitador de THE ROCK aunque les duela y me gustaria saber como aguantas con tanto esteroide en tu cuerpo... claudia piensa q le escribira jajajajajaja sueñas
Fecha: 2007-05-10 14:30:22
 

vero escribió:
hola yo comparto la idea de carlos ademas es un drogadicto laastimosamente nosotros nunca apoyamos a los atletas deverdad xq este por las inyecciones tiene el cuerpo q tiene me lo imagino de 60 años jajajajaja
Fecha: 2007-05-10 14:36:43
 

Antonio escribió:
de guate, la verdad todos esos luchadores son unos payasos drogadictos, es como ir al parq central solo q disfrasados d atletas, se moriran de cancer en la piel por tanto ANABOLICO q se inyectan. payasos
Fecha: 2007-05-10 14:42:06
 

sirey escribió:
pienso q cina no es ni tan feo ni tan guapo pèro puede luchar bien y biste bien mi pregunta es esta casado?
Fecha: 2007-05-21 21:24:43
 

sheila escribió:
john eres el mejor y tu fortaleza es el q te hace ser tan guapo.
Fecha: 2007-06-07 14:52:02
 

evelin yareli nlanco ibarra escribió:
john cena es lo masimo es una su pèr es tre yua en todo su es p`lendor i me fSINA SUS OJOS Y TODO LO DE MAS
Fecha: 2007-06-08 21:30:45
 

marlon jose guerrero Carbonell escribió:
soy tu mejor idolo de el wwe don de peleas tu , por q yo te respeto
Fecha: 2007-06-10 20:13:04
 

juan escribió:
john cena eres el mejor sige ganado ala jentuza esa y tu musica mola no la deje bsss juan
Fecha: 2007-06-16 09:51:01
 

mery vanessa escribió:
john cena es el mejor luchador que hay y en las peliculas que ha realizado se le ve guapisimo sigue asi que eres el mejor.
Fecha: 2007-06-25 10:32:20
 

lizette escribió:
john cena eres el mejor y adenas lo tienes todo hasta un cuerpaso y una linda cara no hagas caso alos tontos te odian porque no tienen un cuerpaso como el tuyo te amo te adoro muchos saludos para ti de parte de cancun y de tu novia lizette soy tu fan 1#
Fecha: 2007-07-04 13:02:06
 

kenya escribió:
eres el luchador mas chido y te kiero un buen y no seas malo dile a rey misterio ke me gusta y ke tanbien lo kiero te cuidas
Fecha: 2007-07-08 14:32:11
 

lipita hermosa escribió:
eres muy bueno
Fecha: 2007-07-09 18:35:02
 

jaffeth escribió:
eres lo mejor te admiro mucho sige asi quiero ke sigas siendo el campeon de la wwe
Fecha: 2007-07-10 12:37:22
 

darling escribió:
eres mi idolo soy de nicaragua y me quiero casar contigo escribeme no te arrepentiras por que estoy ricota te amo escribeme por fis
Fecha: 2007-07-12 20:56:31
 

berenice escribió:
hola soy fan numero 1 de john quisera felizitarte por tus buenas peleas q has dado hata con el mas grande q es kali y has ganado y sigues siendo el campeon de la wwe sigue asi yo solo quisiera hacert una pregunta q signo eres mandenme el mensaje por mi correo gracia john cena le mejor luchador !!!!!!!!!!!!!!! a y quisera el correo de john cena gracias mandmenlo.
Fecha: 2007-07-16 11:11:08
 

natalia escribió:
hola wapeton!! ere lo mejor que ay en esta vida............... quisiera ir a verte cuando vayas a madrid pero no tengo entradas.. weno quiero ponerme en contacto con tigo!!!!! t amoooooo
Fecha: 2007-07-25 11:35:28
 

marcelo chacon escribió:
john cena lo quierosu pelea envengeanceestubo bueno quisiera conocer a john cena soy su hermano le beo pelear cada dia te quiro hermano
Fecha: 2007-07-17 16:02:35
 

dany escribió:
que estas bien perro para pelear i que sigas asiendo la f,u y que ganes otro campeonato
Fecha: 2007-07-19 16:41:51
 

luz karina javier isidro escribió:
jhon cena eres el mejor luchador y te deseo mucha suerte sigue triunfando bayyyyyyyy suerte
Fecha: 2007-07-26 22:30:50
 

ALEXANDER escribió:
SOY ALEXANDER DE VENZUELA Y QUIERO DECIR Q JOHN CENA ES EL MEJOR D LA WWE, MI LUCHADOR FAVORITO Y NUNCA LO DEJARE D APOYAR, AHHH. Y OTRA COSA VERO Y CALOS NO SEAN RIDICULO AL ESCRIBIR LO DE JOHN CENA PORQ ESO NO ES PROBLEMA D USTEDES BRUJAS DEJEN VIVIR PARA DEJARLOS VIVIR A USTEDES. JOHN CENA NO LE HAGAS CASO A COMENTARIOS RIDICULOS Q REALIZA LA GENTE INGNORANTE TU ERES EL MEJOR Y HACI SERA SIEMPRE. ARRIBA JOHN CENA'''''''''''' X MI PARTE T APOYARE SIEMPRE....Q DIOS T BENDIGA SIEMPRE..
Fecha: 2007-07-27 16:56:02
 

IDALIS escribió:
TE AMOOOOOOOOOOOOOOOOOOOOOOOOOOOOO JOHN CENA
Fecha: 2007-07-27 16:57:57
 

melissa gutierrez ziehl escribió:
OLA SOY MELISSA Y SOY DE ENSENADA Y QUISIERA SABER SI UN DIA JOHN VINSA PODIAS BENIR A ENSENADA POR Q TODOS TE QUERESOS ACA Y NO SABES MI PRIMO TIENE LA GORRA TU LLA LA CAMIZA POSTER DISCON Y MUCHAS COSAS OK ENTONCERS BY Y ESPERO Q PUEDAS BENIR
Fecha: 2007-07-29 18:20:23
 

alejandro escribió:
e john cena eres el mejor luchador so tu admirador mi hermano tiene todo de john cena y yo tmben mi computadora tengo tu musica my time is now esta chida a y tmb tengo fotos tullas a soy de mexico a y agregame mi msn es daniel_alejandro302@hotmail.comespero k me agreges eres mi fan #1 bueno te cuidas y espero k ganes este domingo si es k peleas a y no le agas caso a vero ni a carlos son unos bobos k no saven ablar te tienen envidia como tu eres el campeon de la wwe
Fecha: 2007-08-03 23:05:05
 

rosly escribió:
cina es buen luchado por culpa por necsos se salio de la wwe espero q regreses agun dia cina
Fecha: 2010-12-03 15:20:12
 

kike escribió:
Hola ceNa tu eres el mejor luchador del mundo, ojala y algun dia pueda conocrte y soy tu fan#1 mi carnala yyo te queremos 1ch.
Fecha: 2007-08-10 16:19:22
 

cristian antonio cardona osorio escribió:
para mi john cena es el mejor luchador q hay en la historia y yo lo abmiro mucho, john cena sigue haci yo se q tu algun dia ceras el campeon de la wwe DIOS te vendiga chao
Fecha: 2007-08-04 15:27:00
 

cristian antonio cardona osorio escribió:
para mi john cena es el mejor luchador q hay en la historia y yo lo abmiro mucho, john cena sigue haci yo se q tu algun dia ceras el campeon de la wwe DIOS te vendiga chao
Fecha: 2007-08-04 15:30:40
 

andrea escribió:
john eres el mejor john soy andrea y tengo una amiga k le gustas bueno reconozco k eres guapo suerte cena sigue asi
Fecha: 2007-08-20 12:05:24
 

RicHâRd CâBâNâ Mâmâni escribió:
bueno yo no tengo ningun comentario pero si quiero decir que john cina es el mejor luchador de la wwwe.y los que lo retan es mejor que no lo agan por que siempre ban perder ok
Fecha: 2007-08-04 20:50:08
 

KATHUNSHY escribió:
pushii a miii me gusthariiia mushiio konocer a john cena por que el es miii uniiico idolo , es lo mejor de la wwe.... si alguien sabe como conecatrme con el plisss ayudenme... katha
Fecha: 2007-08-20 16:48:12
 

rafael cristian escribió:
hola john cena quiero decirte que sigas in victo con el titulo de la wwe , y manda las fotos cuando peleas te con el gran kali
Fecha: 2007-08-06 15:33:27
 

victor escribió:
eres el mejor me gustaria conoserte en persona res mi fan 1 te quieroooooooooooooo
Fecha: 2007-08-20 20:10:12
 

andy escribió:
hola john cena tu eres mi idolo y sigue asi no vallas a dejar que te quite el titulo de la wwe... eres lo maximo
Fecha: 2007-08-12 17:29:18
 

yenny escribió:
hola cena quisiera desirte que eres el mejor luchador de la wwe
Fecha: 2007-08-12 18:53:41
 

Jeanneth rodriguez escribió:
Eres el mejor, mi hijo es tu fans, le facina como luchas, en lo personal que agrada tu manera de luchar, sigue siendo el campeon de los campeones, por que te lo mereces.
Fecha: 2007-08-21 15:40:34
 

manuel rodriguez escribió:
SOY EL NUMERO 1 FANATICO DE JOHN CENA Y ME GUSTA VER LA WWE NPORQUE ES EL MEJOR PROGRAMA DE TODOS
Fecha: 2007-09-03 15:30:25
 

ana escribió:
john cena eres el mejor y lo sabes y tu sabes k si kieres ganas a todo el mundoo y eres guapisimo lastima k no te pueda conocer ni te pueda escribir bueno un beso JOHN CENA ¡¡ TKM
Fecha: 2007-08-15 15:23:02
 

jeronimo jaramillo garcia escribió:
jhon cena eres el mejor luchador para mi tu me sosprendiste cuando tu cargaste al gran kali
Fecha: 2007-08-18 09:43:17
 

diana brillit escribió:
HOLA SOLO QUIERO DESIRTE QUE PIENSO NO HAY MEJOR PERSONA QUE TU Y MI SUEÑO ES CONOSERTE EN PERSONA CUANDO BINISTE A TIJUANA NO TE PUDE VER POR QUE ESTABA ENFERMA PERO NO PIERDO LA ESPERANSA DE CONOSERTE EN PERSONA ME DESPIDO RECORDANDOTE LO MEJOR QUE HAY EN LA BIDA ERES TU NOLO OLVIDES.
Fecha: 2007-08-18 21:07:09
 

fernie escribió:
cena es el mejor le ha ganado a HHH shawn michaels edge grheat kali le quito el invicto a humaga
Fecha: 2007-08-18 22:04:42
 

gissela escribió:
sabes eres un amor, un chico muy apuesto de fisico y ha la ves se ve que eres una gran persona por eso te admiro por como eres te quiero mucho y cuidate
Fecha: 2007-08-19 10:06:01
 

Dina escribió:
la verdad John Cena eres lo maximo, cuando vienes a Peru? seria genial conocerte personlamente, eres mi peleador favorito...mucha suerte en todo chico lindo.tienes unos hermosos ojos.
Fecha: 2007-08-19 14:00:50
 

barbara escribió:
john cena eres mi preferido
Fecha: 2007-09-05 15:01:33
 

alan escribió:
jhon cena es el mejor del mundo y despues de ti no hay nada igual
Fecha: 2007-09-13 19:35:46
 

verdebella escribió:
john soy una d tus fns y pues k no tengo mxa suerte no tengo tu camiseta y m encantaria tenerla tmb se k no es posible k tu o alguien m ayude a conseguirla pero auk no tenga tu camieta estoy muy feliz de k seas el campeon de la WWE y espeo k siga a si durant muxo tiempo se k no lo leeras pero si alguna vez lo haces m gutaria k lelles mi carta xk kreo k debe riais venir mas a ESPAÑA kreo k pasais muxo tiempo en EE.UU TMB KIERO DECIR T K ERES EL MEJOR + WAPO ETC... Y K NUNCA CAMBIES D CANCION ES LA MEJOR. WAPO PIJO!!!
Fecha: 2007-09-07 11:10:01
 

monse escribo: escribió:
hola john cena soo te kiero decir ke estas bien guapo y ke te amo jajajajajaja eres el mejor de todos pero el MEJOR hay no sabes komo te kiero eres my luchador preferido super preferido y aperte estas bien guapo ah y tu puedes kn todos suerte ilove you kises muak te kiero muxo a y no me pierdo ninguna lucgha tuya y me enkanta tu cancion esta bien ckida jejeje a soy tu fans numero 1 aunke no te pueda ur a ver en persona y sabes me gustaria ke binieran a veracruz o a tampiko hay no sabes komo me guataria hay que chidopero kreo ke eso nunka va a apaar bueno me despido de ti y un super besote y suerte se ke te bva a ir muy bien entodo lo ke tu agas x ke eres el n°1 eres el mejor el mejor de todos suerte bye te kiero muxo muxo muxo y suerte besooss kuidate muxo mua besoso y bye tkm.
Fecha: 2007-09-07 18:26:04
 

erick escribió:
JOHN CENA ERES EL MEJOR DE LA WWE te podrias comunicar conmigo soy tu fan numero1 mi correo es erick.dario@hotmail.com todos mis amigos creian que iva a ganar bobby laslhey pero yo no desconfie de ti
Fecha: 2007-09-07 20:53:28
 

victoria escribió:
t kiero muxo john cena me fascina komo peleas tu eres wapo y de to yo soy tu fan 1 tengo uns gorra igual k la tuya y muxo poster tuyo
Fecha: 2007-09-15 09:41:50
 

flavius escribió:
jo creo k john cena se merce ser el campion wwe
Fecha: 2007-09-17 10:21:50
 

jhon escribió:
jhon cena eres el mejor luxador d toda la historia eres mi idolo tkm
Fecha: 2007-09-15 12:14:40
 

lauritha escribió:
wenooo mirad aki la unika fn number 1 soy yoo desde el primer dia k lo vi toy deseando k llegue el proximo dia para podr volver a verle luxar tngo gans d ver a randi orton derrotado y mas k derrotado por john cina x todo lo k le a exoooo john cina tkm
Fecha: 2007-09-17 11:10:11
 

sergio escribió:
eres el mejor john cena pami k eres el mas hueno de raw i smachk down i wwe i todo presincatch
Fecha: 2007-09-16 07:57:35
 

Vicente escribió:
Todos los que han escrito son unos mentirosos porque en verdad yo soy tu fan numero 1 john cena i dejar que os diga una cosa my time is now
Fecha: 2007-09-16 10:03:55
 

DENISSE DE CINA escribió:
JOHN CENA ERES EL MEJOR LUCHADOR DE LA WWE Y CLARO EL MÁS BUENOTE Y CON UN TRASERO SUPER !!! I LOVE YUO FOREVER !!! ATT:TU NOVIAFAN #1.
Fecha: 2007-09-17 20:37:26
 

mary escribió:
eres el mejor simplemente el mejor, si enverdad lees estos comentarios quiero pedirte q por fa no seas como los demas por q hay mucha gente q deveras te aprecia no los decepciones. yo soy una de tus muchas admiradoras me encanta tu mirada sincera.
Fecha: 2007-09-20 10:04:51
 

ñ´898u escribió:
john es el mejor es yuapisiiiiiiimo y ademas no esta casado quien le pille ha john menuda suerte. john estas bueeeeeeeeeeeeeniiiiiiiiiiiiiiisiiiiiiimooooooooo.eres el mejor luchador de pressing cats.porque le has ganado ha el gran khali. y eso no lo hace cualquiera. com 30 años, ni batista, que es un catzas lo ha hecho. guapos, guapos,guapos,guapos siiiiiiii siiiiiiiiii
Fecha: 2007-09-20 12:48:47
 

paita de la venta escribió:
john cena eres el mejor yo desearia con toda mi alma verte alguna vez en persona porque te quiero te amo eres lo mejor que hay y encima eres rapero,eres actor,eres luchador y luchas porlo que quieres sin rendirte me as dado ejemplo de no rendirme jamas y ojala que nunca dejes de ser el campeon y que vayas subiendo escalones porque te lo mereces y el que diga lo contrario ni caso porque es envidia todo sige asi tkmmm john cena THE CHAMP IS HERE-MY TIME IS NOW.asi se abla te queremos. Fd.2 fans de venta del rayo MIREYA Y PAITA
Fecha: 2007-09-20 15:32:43
 

Potoxa escribió:
john cena eres el meor, no te dejes vencer por los demas,tu si que vales no como otros,muchos besos.La loka perdia por ti.XD
Fecha: 2007-09-20 15:51:16
 

jaja escribió:
Carlos deja empaz a claudia exa puede pensar lo k le de la gana asik te caxas tu claudia tranky me caes bn jj
Fecha: 2007-09-21 15:22:46
 

caroline escribió:
hola le mando un besote a john es uno de los mejores del mundo soy su fanatica y lo amoo muxooooooo un besote a santiago de chile
Fecha: 2007-10-01 09:21:29
 

Miguel Humani C escribió:
HOLA JOHN CENA SOY TU FANS QUISIERA IR A VER TUS PELEAS SEBE ERES EL MEJOR COMO QUESIERA SER COMO TU CHAU CUIDATE
Fecha: 2007-09-27 13:45:32
 

Wendy escribió:
Hola jonh cena eres el mejor te admiro mucho !!!!eres genial!!!...........
Fecha: 2007-09-24 04:16:02
 

issam escribió:
hola cena soy un amigo tuyo desde marruecos es el norte de africa bueno john eres mi favorito en la luxa libre asi que yo cuento contigo tienes que conseguir el sinturon de los pesos pesados el de este año vale tio y ademas quiero saver si eres rapero de verdad o no vale amigo y otra cosita mas si puedes el disco ese el que te ponen siempre cuando entras me lo puedes enviarlo en mi mesnger para que puedo escuxarlo con mis colegas vale tio tio te deceo todo lo suerte en tu carrera vale venga un saludo fuerte
Fecha: 2007-09-24 09:19:36
 

brujita escribió:
wns jonh cena ers el mejor d tods y apart ests mu bueno dsd el primer dia k vi pressing cats me gststes muxo y aora solo lo veo x ti te deseo lo mejor y k gnes muxas mas cmpeticiones muxos bsts kuidate wapo
Fecha: 2007-09-24 11:41:28
 

kevin escribió:
hola john cena yo soy tu fans quisiera ir a ver una de tus peleas con mr. kenedi para que tu le ganes te quiero decir que yo con mis amigos juego a las peleas como tu.cuidate mucho chau
Fecha: 2007-09-24 19:45:26
 

sergio escribió:
Cena me gusta mucho tu musica tienes que dar un concierto yo iria a verlo
Fecha: 2007-10-01 13:11:28
 

cynthia escribió:
cena eres el mejor y el mas guapo sigue asi
Fecha: 2007-09-28 16:49:57
 

Elena escribió:
john te amo si fuera a verte luchar y te tocara me daria un infarto o me desmallaria nunca me pierdo ningun combte tuyo y cuando sale tu music ya se me acelera el corazon
Fecha: 2007-09-29 02:11:17
 

SOULEING CHANG escribió:
eres lindo y gordito
Fecha: 2007-10-04 18:56:17
 

ester y alison escribió:
k eres el mejor ademas de estar komo un tren te adoramos!!! y ven a españa otra vez e ido a todas tus luchas te amamooossss....
Fecha: 2007-10-13 14:16:15
 

lordi escribió:
soy lordi y me canta ria conocerte soy un gran fan tu yo y mes gu tari a terner tu msm y tu atografo
Fecha: 2007-10-06 12:49:59
 

yesenia coca escribió:
hola eres re lindo y hermoso me gusta tu musica y me gustaria hablar contigo eres el mejor luchador que hay en la wwe eres lo maximo el mejor luchador que vi en mi vida soy tu fans n 1 tengo llenioso de tus poster en mi cuarto tienes el mejor cuerpo que quisieran tener todos eres un rapero de lo mejor y te apoyo en todo te amndo muchos besotes
Fecha: 2007-10-06 14:55:43
 

PAITA y MIREYA escribió:
john cena recuperate de la lesion aki te vamos a estar esperando k somos las k mas te keremos ANIMO TU SIGE ASI K SOLO ESTAMOS ESPERANDO EL MOMENTO K VUELVAS A LUCHAR Y A KITARLE EL TITULO A KIEN TELO AYA ARREBATAO TIO WENO TKMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM
Fecha: 2007-10-07 03:33:13
 

vanessa escribió:
estoy mas que segura que john cena es el mejor luchador de la wwe y aunque les duela a muchos el volvera con todas las fuersas que el se caracterisa y recuperara lo que por su estado tuvo que dejar y volvera a ser el numero uno que nunca debio de dejar de serlo john eres el mejor y muchas personas estaremos esperando tu regreso aaaaaaaaaaahhhhh eres el HOMBRE MAS GUAPO QUE HAYA EN EL MUNDO CARISMATICO Y TIENES LA MIRADA MAS HERMOSA Y MAS TIERNA QUE HABIA VISTO TE CUIDAS CHAU
Fecha: 2007-10-10 17:38:12
 

yessik escribió:
es mi chorvoooooooooooooooooooooooooooo!!!!!!!!!!!!!!! asiq a dejarlo!!!!en la kma es el mejor!!!!!!!!!
Fecha: 2007-10-08 12:12:55
 

k!k!s escribió:
sabes que ERES EL MEJOR estas super guapo y bien dotado... VEN PRONTO A MEXICO TE AMO You know that YOU ARE THE BEST these super endowed gallant and good(well)... COME SOON TO MEXICO I LOVE YOU
Fecha: 2007-10-08 12:27:09
 

Jeff hardy escribió:
JHON CENA ES UN GRANDISIMO LUCHADOR, PERO... PREFIERO A JEFF HARDY
Fecha: 2007-10-11 12:39:54
 

irene escribió:
sige asi guapo no pierdas el titulo
Fecha: 2007-10-12 09:22:23
 

nazaret escribió:
soi nararet dl puerto sant maria (cadiz) pues nada desir k para mi john cena es er mejon y k me encanta es wapisimo y me wusta muxo komo va rapeando bamo k es uniko esta wenisimo k daria yo x konoserlo jeje bueno osdeho muxos besos jonh cena tskmm bess
Fecha: 2007-10-13 09:43:22
 

cristina escribió:
ahhh ola mi john cena eres nustro idolo de mi amiga dayana sanchez carmona y de yo cristina alvarez amante te damos nuestros msn cristi_1996a@hotmail.com y dayana _1996a@hotmail.com te amamos!!!
Fecha: 2007-10-14 07:57:41
 

ANDREA escribió:
estas to weno para mi eres el mejor tu puedes con randy orton y dile a tu padre de parte de una fan k no se fie de randy orton y k se cuide muxo y tu tambien. Sigue asi wapo
Fecha: 2007-10-15 11:06:17
 

fran escribió:
eres el mejor de la wwe
Fecha: 2007-10-18 10:31:28
 

andrea escribió:
xe esk el john cena es el mejor eso no aze falta dudarlo john cena tkm eres el mejor luxador y el + wapo.tkm randy orton(muerte) jajajaja john campeon wwe
Fecha: 2007-10-20 10:40:47
 

claudia escribió:
JOHN CENA ERES UN TONTO COMO PUDISTE PERDER COM RANDY ORTON
Fecha: 2007-10-20 17:55:30
 

LIZSETH escribió:
jhon cena te amo eres el mejor luchador de la wwe y espero que te recuperes muy pronto para que vuelvas a ser el campeon de la wwe por que randy orton no se lo merece por que no es el campeon aunque no tengas el titulo de la wwe para mi y para todos los que te queremos sigues siendo nuestro el campeon tu fuiste el campeon , eres el campeon y seguiras siendo el campeon chau y que te recuperes pronto
Fecha: 2007-10-19 19:24:20
 

Alex escribió:
john cena es el mejor como no vuelvas a luchar me mato john john john cenacena
Fecha: 2007-10-21 10:49:21
 

gloria escribió:
hola john cena kiero decirte ke sueño con tigo todas las noches y ke me encantaria conocerte ojala se kemaran todos los ke te odia junto con randy orton y mr.kenedy en especial.espero ke te recuperes pronto porke no puedo estar mas de 6 mese sin verte.mmi mesenger es hipica-21arrobahotmail.com y tambien si gente ke viva en españa se kiere poner en contacto conmigo ese es mi mesenger.sobre todome gustas tuporke te pareces a un muxaxo de mi clase ke tanbien me gusta muxo y ke estoy enamorada de el .bueno muxos besos para ti y para tu padre y a ver cuando te pasas por españa o extremadura
Fecha: 2007-10-22 09:35:00
 

carlos poty escribió:
JOHN CENA ES EL MEJOR, IS DE BEST
Fecha: 2007-10-22 17:40:26
 

YANNIELYS ESCALONA escribió:
Admiro mucho a JHON CENA no solo por como se ha superado sino tambien por como defiende sus valores familiares lo cual segun mi criterio es de gran relevancia... Ademas mantiene un estrecho contacto con sus millones de fanaticos... pelea EXCELENTE y es BELLISIMO... ESTA DEMASIADO BUENO y como si fuese poco el ESTILO LE SOBRA!!!!!!!!!!!!!!!!! LO ADORO Y ADMIRO MUCHO........!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Fecha: 2007-10-26 09:43:21
 

lety escribió:
John Cena eres el mejor YOU ARE THE BEST espero k vuelvas a luxar pronto sino me muero venga recuperate pronto y besos pa ti y pa tu padre xao
Fecha: 2007-10-23 13:40:18
 

andrea giselle soto escribió:
Jhon Cena es el mejor de todos porque es joven y logró muchas cosas y al que piense que Jhon Cena es una basura se equivoca porque ese o esa que comente de esa manera está realmente loco y que me mande un mensaje que piensa de Jhon Cena a giselle_kudai@hotmail.com, ya a los que amen a Jhon Cena porfavor mandenme un mensaje a mi correo cual es el correo de Jhon Cena y asi vompartimos las ideas. I LOVE YOU SOY TU FAN NUMERO 1 ATTE.GISELLE
Fecha: 2007-10-23 15:20:41
 

joakin escribió:
hola john cena como estas soy joakin uno de los fans numero 1 me gusta como peleas recuperate amigo eres el mejor de presing caht bueno adios recuperate y ser el ganador de todas la peleas suerte john cena
Fecha: 2007-10-28 08:34:51
 

cesar escribió:
hala espero que me contactes soy tu admiradory recuperate y vas a ganar todas tus luchas no importa cual dificil sea.
Fecha: 2007-11-01 13:35:34
 

maite g.m escribió:
joh cena eres el mejor el mas wapo de todos quemas podemos pedir deti. asi ya se el que que estes solteroooooooooooo.te keremos mazooooo.wenorro.
Fecha: 2007-11-03 09:09:15
 

andrea carolina escribió:
JOHN CENA ERES LO MEJOR TE KIRO MUXITO Y ESPERO QUE CUANDO REGRESES LE DES DURO A RANDY QUE LO DETESTO TE AMO JOHN CENA ERES LO MAXITO MILES DE BESOS Y MILES DE ABRAZOS SOY TU FAN #1 Y RECUPERATE PORFA ERES DIVINO
Fecha: 2007-11-01 19:34:17
 

maria renè escribió:
eres EL MEJOR JOHN CENA SOY FANATICA TUYA Y AUN K RANDY ORTO AYA GANADO EL CAMPEONATO PA MI EL CAMPEON ERES TU CHAU
Fecha: 2007-10-28 20:37:30
 

WENDY LOPEZ escribió:
JOHN CENA ES EL MEJOR NADIE PUEDE CONTRA EL SIEMPRE LO APOYARE SOY SU FANS DESDE NI CARAGUA
Fecha: 2007-10-29 21:18:57
 

Norma Sanchz escribió:
Hola John cena, tienes muchos admiradores en colombia bogota y yo soy la #1 eres el mejor.......... Norma
Fecha: 2007-10-30 11:03:55
 

jenifer bustamante gomez escribió:
hola john cena tengo muchas cosas tullas eres muy guapo y ademas peleas muy bien te saves defender muy bien y atu enmigo saves como vencerle y sobretodo de randy orton bueno adios guapo u8n beso y espero que me escribas muy pronto vay
Fecha: 2007-10-31 07:25:46
 

jose escribió:
john eres el mejor me gustaria conocerte en persona eres mi numero 1
Fecha: 2007-10-31 10:50:25
 

cristina escribió:
Jonh cena eres el mejor no dejes k te ganen y sigue siendo asi de guapo yo tengo una hermna que te quiere mogollon tiene un monton de fotos tuyas y cadas vez que te be en presincarts se muere por verte de todo lo que te quiere todo el mundo te quiere a ti y a batista para mi y mi hermana sois lo smejores
Fecha: 2007-11-02 08:32:22
 

NOELIA escribió:
JOHN CENA NO DEJES QUE RANDY ORTON TE HAGA MAS DAÑO SABES PORQUE POR QUE HERES EL MEJOR Y LO DE LAS PASTILLAS DE JOHN CENA SON MENTIRAS VI UN VIDEO QUE NO PARA DE HACER GIMNASIA .TE AMO A PASA POR LA TRAVESIA DE VIGO CUANDO PASES POR ALLI ESTOI TODA MILITAR ESCEPTO LOS ZAPATOS Y CON GORRA MILITAR MACHACA A RANDY ORTON ESPERO QUE LO VEAS I LOVE YOU SOI TU FAN #1
Fecha: 2007-11-01 03:15:31
 

isauro escribió:
john cina eres lo maximo me gustria `verte pèlear con batista de otra ves si ok
Fecha: 2007-11-07 08:51:38
 

la mejor fans de john cena escribió:
john cena te keremos!!!!!!!!!!!!!!!!!!!!!!! k sepas ke estas muy bueno !!!!!!!!!!!!!!!!! tkmtkmtkmtkmtkmtkmtkmtkmtkmtkmtkmtkm
Fecha: 2007-11-02 16:11:09
 

andrei escribió:
john cena eres el mejor,machacalos a todos
Fecha: 2007-11-04 06:56:49
 

beatriz y cristina escribió:
nos encanta como plas somos tus fans bss muach
Fecha: 2007-11-04 08:37:42
 

oscar escribió:
eres muy buen luchador arrebatale el titulo a randy
Fecha: 2007-11-06 04:31:13
 

franco escribió:
yon cena eres el mejor cuando te mejores quiero q le des una palisa a randi orton
Fecha: 2007-11-08 15:29:27
 

saida cerdan cutanda escribió:
jhon cena deseo verte en persona y pedirte un autografo da lastima que no seas de albacete pero si vienes estoy en albacete c/iris nº16 3ºderecha ojala vengas a mi casa pero seguro que no sera posible pero si vas o no vas a venir enviame un email.
Fecha: 2007-11-12 08:10:06
 

JOHNS escribió:
decir que john cina es uno de los mejores y tamvien mandarles sludos a ustedes si y quiero que me manden saludo mediante pelea a la familia sntamaria
Fecha: 2007-11-08 17:03:13
 

fabiola escribió:
jhon eres el mejor luchaddor del mundo te quiero un monton espero q te recuperes pronto sigue adelante eres mi idolo te amooooo
Fecha: 2007-11-12 09:10:45
 

Francisco Ramos escribió:
Hola John Cena, tu eres lo máximo; uno de los mejores luchadores. Te admiro mucho; y,quiero que me digas cuales son las cualidades de un luchador. Quiero que me digas como entrenas para resistir tanto. Siga adelante...
Fecha: 2007-11-19 09:53:24
 

marinita escribió:
john sigue luchando asi de bien!!!! todos mis amigos del pueblo se pasan el dia ablando de ti, y tienen tus canciones en el movil y cromos tuyos y fotos......te ablo de gente de leza, un pueblo de la rioja alabesa que esta cerca de laguardia.suerte en tu proxima lucha, fijo que como siempre ganas!!!!
Fecha: 2007-11-14 06:38:20
 

masiel escribió:
aqui nadie es el admirador numero 1 de cena la primera soy yo es mas les confieso que estoy enamorada de el en totalidad tengo de todo de el fotos camisetas etc,mi esposo esta celoso de el cuando vemos las luchas umtos se enoja, ajala que siga luchando asi y que no deje que nadie le apague sus suen^os y ojala que jamas haga drogas yo lo amooooooooooooooooo con todo mi corazon un beso de una dominicana con sabor te amooooooooooooooooo mi vida
Fecha: 2007-11-14 19:54:13
 

zara escribió:
john cerna es el mejor te quiero yo lo veo lucha libre todos lo dias eres el major
Fecha: 2007-11-15 11:34:50
 

jans elvest paredes raymundo escribió:
john cena 100pre sera el campeon de la wwe y mejor luchador d la historia " el rapero " " CENA "
Fecha: 2007-11-15 20:38:43
 

Jose escribió:
Jon cena eres el mejor de la WWE i quiero de que lo siguas siendo.
Fecha: 2007-11-15 23:50:26
 

nathaly escribió:
hola kiero k sepas john cena k eres un gran luchador i k te kiero mucho y kisiera conocerte en persona eres muy lindo
Fecha: 2007-11-20 07:47:27
 

deyra escribió:
A MI ME PARECE QUE JOHN CENA ES UN RIDICULO QUE SE CREE MAS QUE LOS OTROS LUCHADORES LO DETESTO. SOY DE PANAMA`.
Fecha: 2007-11-29 10:03:18
 

deyra escribió:
A MI ME PARECE QUE JOHN CENA ES UN RIDICULO QUE SE CREE MAS QUE LOS OTROS LUCHADORES LO DETESTO. SOY DE PANAMA`.
Fecha: 2007-11-29 10:03:12
 

andrea carolina escribió:
JOHN CENA TE AMO ERES EL MEJOR APARTE DE QUE ESTAS DEMASIADO GUAPO ERES SUPERBACANO Y YA ENTENDI PORQUE HAY PERSONAS QUE HABLAN MAL DE MI BEBE JOHN CENA YO PS SOY DOCTORA Y ENCONTRE SU ENFERMEDAD: TRANSTORNOS MENTALES SEGURO FUE PORQUE EN SU NIÑES SUS PADRES LE HICIERON ALGO MALO O ES QUE SON TAN FEOS QUE LE TENGO NOMBRE A LA OTRA ENFERMEDAD ESA SISE LLAMA ENVIDIA DE ESTUPIDOS PORQUE JOHN CENA EL 95 DE LA MUJERES LO ADORAMOS A VER A LOS LOSERS QUE ME QUIERAN PELEAR AGREGENMEN a.n.d.r.e.a.0993@hotmail.com hay no mentiras a los que si esten bien de salud y mentalmente mejor que me agregen ellos JOHN CENA TE AMO UN RESTOOOOOOOO MI BEBE PRESIOSO
Fecha: 2007-11-20 09:19:39
 

diego ramirez ore escribió:
hola john cena eres mi idolo como tu no ay otro tu siempre seras el mejor y retiene tu titulo de la wwe soy de peru tengo 9 años i un dia quisieras qe me escribas un mensaje en mi mail y tengo tu titulo de la wwe y su ropa chao cena.
Fecha: 2007-11-16 18:16:06
 

diego ramirez ore escribió:
hola john cena eres mi idolo como tu no ay otro tu siempre seras el mejor y retiene tu titulo de la wwe soy de peru tengo 9 años i un dia quisieras qe me escribas un mensaje en mi mail y tengo tu titulo de la wwe y su ropa chao cena.
Fecha: 2007-11-16 18:16:36
 

diego ramirez ore escribió:
hola john cena eres mi idolo como tu no ay otro tu siempre seras el mejor y retiene tu titulo de la wwe soy de peru tengo 9 años i un dia quisieras qe me escribas un mensaje en mi mail y tengo tu titulo de la wwe y su ropa chao cena.
Fecha: 2007-11-16 18:16:58
 

Soy Marta Garraleta escribió:
eres guapisimo y me muero por ti
Fecha: 2007-11-17 09:26:31
 

santiago torres escribió:
re aspero como pelea es mi iolo como rey misteryo y severos cuerpos mas con la gorra
Fecha: 2007-11-17 12:52:25
 

jessenia escribió:
eres muy mino cena, te comeria completito a besos
Fecha: 2007-11-20 15:32:51
 

carolina escribió:
eres un papi, cueraso uno de los mejores del mundo te amo
Fecha: 2007-11-26 13:41:49
 

jose escribió:
los q no me respeten a john cena le meto una piña q se qdaran sin dientes john cena es el mejor de los luchadores el trio perfecto es john cena,undertaker y rey misterio
Fecha: 2007-11-26 13:46:48
 

elmer escribió:
hola jhons hola mejores y pronto regrese a la actividad de row y o te ablo des de bolivia espero respuestas
Fecha: 2007-11-26 14:35:54
 

wendy escribió:
John Cena es un ejemplar de los pocos hombres que existen en este mundo. el que se atreva a negarlo es porque esta celoso.
Fecha: 2007-11-17 19:16:53
 

Maria Jesus escribió:
JOHN-CENA todos los que estamos aki escribiendote es poqe te adoramos y aunk otros piensen lo contrario que luchen ellos contigo si son tan hombres recuperate aki tamos todos deseando luchas como nadie KIEN ESTE CONMIGO QUE ME AGREGE:marydelaventa@hotmail.com VIVA JOHN CENA
Fecha: 2007-11-18 02:47:41
 

elena escribió:
john cena es muy bueno a mi me gusta pero tambien me gusta rey mysterio y randy orton
Fecha: 2007-11-18 12:23:58
 

adolfo escribió:
jhon cena quiero saber si tu me puedes mandar tu cansion a mi correo la de "my time is now" pofavor
Fecha: 2007-11-22 22:18:46
 

gaby escribió:
holas john para mi eres de los hombres mas lindos del planeta y ahora que estas casi fuera del rin quiero que sepas que voy a esperar un año por ti y el dia que vuelvas volvere a esta pagina antes no tus ojos tienen la exprecion de un osito cariñoso te amo chauuuuuuu
Fecha: 2007-11-19 08:43:48
 

gladys camas escribió:
hola: te amo
Fecha: 2007-11-26 21:05:51
 

esmeralda escribió:
John te amo sigue así tengo 12 añitos pero eres mi ídole.TI AMO.Call me al 933858310.
Fecha: 2007-11-30 07:23:56
 

alicia escribió:
john cena estas super bueno te amo te adoro te esperamos devuelta en la wwe x 100pre nuestr CAMPEON DE LA WWE iloveeeeee aqui esta mi msn aliciad_8826@hotmail.com escribanme
Fecha: 2007-11-30 18:44:50
 

edzon varillas escribió:
hola john cena como estas soy uno de tus fanaticos cuando regresas a apelear y recuperar tu titulo y tambien sacar para toda su vida a randy orton de su carrera john cual es tu corre me lo puedes embiar mi correo es etim_sagitario@hotmail.com soy de peru chauu cuidate y recuperatev pronto de tu lesion y arecuperar el titulo.
Fecha: 2007-11-30 20:10:06
 

nico escribió:
hola me encantas como luchas eres mi faborito
Fecha: 2007-12-04 14:08:58
 

kiara escribió:
jon cena es un verdadero cuerooooo es lindo es luchador excelente es un amoooooooooooor jaja es mi papi,mi rey,mi cuero
Fecha: 2007-11-28 18:23:11
 

Hillary escribió:
Bueno solo te queria decir que estas super demasiado guapo y aqui en costa rica decimos que estas hecho un miamorzote como dios te trajo al mundo hecho un rico no te enojes si ves esto pero no se si eres casado o tienes novia mejor quedate solterito mejor visita costa rica bye
Fecha: 2007-11-28 22:23:09
 

Hillary escribió:
Bueno solo te queria decir que estas super demasiado guapo y aqui en costa rica decimos que estas hecho un miamorzote como dios te trajo al mundo hecho un rico no te enojes si ves esto pero no se si eres casado o tienes novia mejor quedate solterito mejor visita costa rica bye y ers el CAMPEON DE LA WWE
Fecha: 2007-11-28 22:24:08
 

Mery escribió:
Quiero decir q amo a john cena!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! porfavor denme su correo o algo asi para mandarle un mensaje graxxxxx
Fecha: 2007-12-01 17:46:26
 

Mayte escribió:
HoOla john espero q leas todos estos mails xq son de gente que t kiere un buen como yo... bueno yo TE AMO!!!!!!!! creeme q para mi no exist mjor luchador. mjor hombre, y mjor persona q tu.. kisiera conocertey obio q si m conocieras te enamorarias d mi... escribme a mi correo xfa. te amoooooooooo!!!!!!!!!!!!!!!!11111 muxooo besozzzz bye. TE AMO Y EN VDD DARIA TODO X TI!!!!!!
Fecha: 2007-12-11 22:09:07
 

patty escribió:
Sigue adelante, enseñales a esos resentidos que te odian que eres el mejor, te ammmmmmooooooooooooo que sigas siendo la estrella iluminadora de la wwe
Fecha: 2007-12-05 18:17:25
 

patty escribió:
John Cena, Me gustas muchoooooooooooooooooooooo sigue cuidando esa figura que tienes ok escribeme
Fecha: 2007-12-05 18:21:49
 

jesus david escribió:
HOLA A TODOS BUENO LO Q YO QUERIA DECIR ES Q A JHON CENA SIEMPRE EN CUALQUIER LUCHA VA A GANAR SE LO ASEGURO Y AUNQ PIERDA SU TITULO SIEMPRE RECUPERARA SU TITULO ES EL MEJOR LUCHADOR Q HE VISTO EN MI VIDA Y AMIS AMIGAS LES GUSTA VER SIEMPRE CUANDO JHON CENA PELEA CON OTROS LUCHADORES:MI NOMBRE ES :JESUS DAVID: ME DICEN "EL CHUS"
Fecha: 2007-12-06 17:45:48
 

CESAR jOSE escribió:
Bueno lo q me gusta de john Cena es que entra a lucha y nunca sale perdindo y me gustaria conocer xd tu fans numero 1
Fecha: 2007-12-06 20:31:10
 

jhon carlos escribió:
hola yo soy jhon tanbien soy su tocayo de cena ya k soy uno de sus fanaticos k mas lo admira sobre todo cuando hace esa destresa del FU o el STFU yo soy de peru me gustaria cena volviera ala lucha de nuevo por ke el estupido de orton es un babas con el titulo y kisiera ke este joven atleta se enfrentara a la roca pero para mi y mis amigos lo mas importante es ke pronto te rcuperes i vuelvas al ring y seas el campeon.
Fecha: 2007-12-10 15:35:55
 

sarita escribió:
hola jhon cina q tal pues solo queria saludarte ps y q seas el mejor luchador del mundo
Fecha: 2007-12-08 17:25:44
 

karla alejandra tovar serna escribió:
lla keremos ke cena regrese porque nos gusta como lucha y esta muy guapo y tambien todos lo de la lucha de l amegor wwe porsupuesto y lo ke me gusta de las llaves de cena la ke mas nos gusta es la de la fu dfu bueno todas bueno me despido los keremos a ka en mexico
Fecha: 2007-12-08 18:33:33
 

frack anthony escribió:
hola como estan todos bueno mis respetos al campeon de los campeones jhon cina,eres lo mejor yo ya toy practicandomelo tus llaves eta dificil kisas me enseñes p un dia bueno chau tu puedes jhonnnnnn n1 tu fans mi msn es anthonyus_frnck@hotmail.com
Fecha: 2007-12-09 21:24:38
 

estefany alejandra sanchez yunda escribió:
hola como estas jhon cina eres el mejor de las peleas y espero que vallas al wwe tienes que ir porque eres el super campion y queremos que vallas a pelear porque si no vas te quitan el titulo y tu ers el super campeon porque por la culpa de ses imbesil te descalificaron y ese se hace el chulo y ademas es un tramposo y si vas a pelear si quieres te traes atu amiga maria ono se que es bueno me despido campeon que tengas mucha suerte en tu bida no te olvides que eres el campeon y si tienes hijos cuentales todo lo que te a pasado
Fecha: 2007-12-10 09:10:45
 

yeray escribió:
john cena eres lo mejor de la wwe aunque te ayas lesionao a mi me digual que te lesiones si de toas maneras seguire siendo uno de tus muchos fans
Fecha: 2007-12-12 16:52:01
 

freddy escribió:
bueno quiero decir queyoni cina es el mejor del mundo esel mejor luchando cantando y actuando mi msn es el-campeon94@hotmail.com agregenme john cinaeres el megorrrrrr
Fecha: 2007-12-12 19:42:29
 

david escribió:
quiero peleas de jhon cena
Fecha: 2007-12-12 20:02:21
 

JUDY escribió:
JOHN ERES LO MAXIMO TE ADOROOOOOOOOOOOOOOOOO
Fecha: 2007-12-13 10:37:12
 

lizeth escribió:
quiero su correo de john cena plis
Fecha: 2007-12-13 07:39:33
 

martuki escribió:
estas k t sales madre mia
Fecha: 2007-12-14 12:29:33
 

isabel escribió:
hola cena eres el mejor luchador que conosco sabes tal vez algun dia re pueda conocer y cumplir mi sueno pero se que es dificil pero no pierdo las esperanzas porque yo soy de peru sabes te admiro en monton nunca te cambiare caheuuu te kelo muchooooooooooooooo.
Fecha: 2007-12-14 18:00:59
 

maaapiii aLbaaa xurtiiss escribió:
cenaa el amOo!! tQqqqqqqqqqqqqqqqqqqqqm
Fecha: 2007-12-19 04:44:01
 

laura escribió:
ola tengo munchas ganas de conocerte que te kiero un monton i soi una fan de las primeras , i aunque sea un chica me incanta como luchas bueno adios i que ganes mas campeonatos
Fecha: 2007-12-15 14:27:52
 

jose escribió:
ola john cena para mi eres el mejor de WWE vales mucho mas de lo que pareses no hay otro mejor que tu ni gran kali jajaj weno si puedes comunikate cnmgo vale te dejop mi msn:jo_x_ma@hotmail.com porfavor contactese conmigo y no cambies nunca
Fecha: 2007-12-16 11:06:55
 

Gabriela escribió:
uyyyyyyyyyyyyy john cena esta como quiere ademas que es el mejor de la wwe no hay nadie como tu eres el unico si tienes tiempo alguna vez quisiera q te comuniques con migo soy una gran admiradora tuya y espero que nuevamente seas el campeon de la wwe. te cuidas un beso chauuuuuuuu
Fecha: 2007-12-16 16:13:10
 

fernandinho escribió:
hola cina como estas para todos tu fanss de peru eres lo mejor y siewmpre seras el mejor
Fecha: 2007-12-16 18:15:08
 

sara escribió:
jhon cena es una persona fantastica un luchador con garra coraje i valentia parami eres espesial un anguel que quisiera que me hable
Fecha: 2007-12-16 21:29:26
 

norberto escribió:
o0la eres lo mejor cena ojala y vuelvas muy pronto de tu lecion y recuperes el titulo de la wwe buuuu!!!! sssss
Fecha: 2007-12-16 23:24:34
 

pau escribió:
hola a mi magrada rey misterio batista enterrador i john cena
Fecha: 2007-12-20 12:52:06
 

santi escribió:
john cina vs rey misterio seria un buen combate berdad.cual es tu mesenger?si tienes claro. que sepas que te admiro pero admiro mas a rey misterio. animoooooooooooooooooooooooooooooo.
Fecha: 2007-12-21 13:40:55
 

GUSTAVO escribió:
eres super algundia me gustaria conoserte en persona yo quisiera ser como tu
Fecha: 2007-12-21 15:54:26
 

samanta escribió:
hola soy una persona que admira mucho o talvez vastante a yon cena y mis sueños es conoserlos algun dia en carne y hueso y que importa si son drogadictos al fin es su vida no el de los demas. chauuuuu.
Fecha: 2007-12-21 17:37:17
 

JOHN AVILA escribió:
quiero que me escribas para saver tu correo y el de john cena
Fecha: 2008-01-02 12:54:48
 

jose escribió:
john cena es el peor y randy orton se sale pk pana a john cena pk tiene el cinturon de la wwe y nadie se lo va a kitar ojala no vuelva nuka
Fecha: 2007-12-22 17:20:05
 

Patricia escribió:
Hola! John Cena te quiero,eres el mejor y...Brandy Orton you are silly!John Cena me gustaria tener tu msn y tmb si puede ser tu correo,jeje,aunque se que no me lo vas a dar...pero bueno! Quiero a pressing cats y te quiero a ti,al duendecillo verde,a Batista(te amo) y sobretodo a...el rey Misterio!!!!!!!!!!!!!!!!!!!! **besitos**
Fecha: 2008-01-04 09:20:29
 

kaxy escribió:
ami me encanta john cena estoi loka por el jejejejeje bueno na q el q qera ablar conmigo q me a gregue a su msn y ablaremos xao bss
Fecha: 2008-01-05 05:40:46
 

susan escribió:
john cena soy tu fans nro 1 desde peru ;y odio a randy orton por lo que te hiso:para mi eres el mejor q todos en peru te amamos cudate y cuida tu figura . adios
Fecha: 2008-01-08 19:15:17
 

susan escribió:
john cena soy tu fans nro 1 desde peru ;y odio a randy orton por lo que te hiso:para mi eres el mejor q todos en peru te amamos cudate y cuida tu figura . adios
Fecha: 2008-01-08 19:16:08
 

juaz escribió:
hola tu si eres un estupido no fuiste capaz de enfrentar tu edad porque tu pene esta mas pequeño que un chito
Fecha: 2008-01-08 19:21:36
 

juaz escribió:
hola tu si eres un estupido no fuiste capaz de enfrentar tu edad porque tu pene esta mas pequeño que un chito
Fecha: 2008-01-08 19:22:07
 

miguel escribió:
jon cina se merece el canpionato de w por que de que yo veo la lucha de jon cina evisto que es el mejor
Fecha: 2008-01-06 18:15:20
 

"BLIN BLI" escribió:
ERES UNO DE LOS MEJORES PELEADORES QUE E VISTO EN TODAS LAS PELEAS DE LA ..............WWE........................... SALES Y ES POR ESO QUE JON CINA SE MERECE EL CAMPEONATO DE LA WWE SALES ....A .....D ......I .......O ........S
Fecha: 2008-01-06 19:55:06
 

susan escribió:
john cena quiero tu correo por fabor ;te lo pido comouna de tus fanaticas escrieme a luna-225: eres un papasito soy de peruuuuuuuu
Fecha: 2008-01-08 19:24:49
 

Deysi Castillo escribió:
hola espero q estes bien soy una de tus fans q te adoran soy de bolivia cochabamba ojala y regreses sano y fuerte desde aqui te estare apoyando besos espero que leas mi mensaje cuidate chauuuuu besos
Fecha: 2008-01-09 16:40:56
 

andres larrubia hoyo escribió:
john cena el mejor del mundo sige asi de melilla
Fecha: 2008-01-09 06:05:21
 

joseco escribió:
hijo aqui hay puros mama guevos viva la droga y bueno cena la musica de la mafia burda de cartelua soy de venezuela dela carucieña cartel aqui mucho malandreo viva las drogas y chavez er gollo
Fecha: 2008-01-22 13:22:30
 

santiago christiansen escribió:
hola Soy santi y soy super admirador de cena cuando lucha le pone todo su empeño y a mi no me empeso a gustar cuando recien empeso pero ahora si el es el mejor de la WWE y es una capo jOHN CENA SOY DE ARGENTINA MI msn es Santic_luro@hotmail.com por favor responde che todos los de la wwe son malos va batista no casi todos y mr kennedy es un tonto y randy orton te lo dijo yo sos um maldito lo lesionaste a cena y todos no te quieren eres una maldito estupido The champ is here chau
Fecha: 2008-01-16 09:03:15
 

joseco escribió:
hijo aqui hay puros mama guevos viva la droga y bueno cena la musica de la mafia burda de cartelua soy de venezuela dela carucieña cartel aqui mucho malandreo viva las drogas y chavez er gollo
Fecha: 2008-01-22 13:23:01
 

Miriam escribió:
Hola John Cena soy Miriam de Bolivia eres lo maximo me encanta la forma en que peleas ademas que eres muy simpatico pero lo que mas que me gusta de ti es que cuando peleas no haces trampas y deseo de todo corazon que te recuperes pronto. Sigue peleando con la misma valentia y nobleza que solo tienes tu y algunos mas yo soy y sere siempre tu admiradora. Este es mi correo y quisiera que me escribas porfa tay453@hotmail.com Dios te Bendiga a ti y toda tu familia . Hasta siempre eres el Mejor :) no te olvides estare esperando anciosamente que me escribas.
Fecha: 2008-01-18 08:46:13
 

carlos escribió:
ola john agregame vale soi un gran fan tuio para mi tu siempre seras mi campeon cuando agas un convate en raw di te lo dedico a ti mi amigo carlos marin.
Fecha: 2008-01-19 17:37:14
 

maria fernanda escribió:
hola john cena soy fernanda de costa rica eres mi favorito megusta como peleas tambien quiero desirte que eres muy guapo simpatico y muy papasito a tambien te manda saludes mi mama alejandra y cuando vuelvas acompetir acuerdate de tu amiga fernanda bueno que dios te acompañe siempre mi correo es fernuchis_1991@hotmail.com
Fecha: 2008-01-20 10:09:58
 

oliver escribió:
jhon cena es el mejor detodos yo quisiera conoserlo y tambien es el mas fuerte detodos
Fecha: 2008-01-20 11:42:53
 

claudia escribió:
jonh cena eres muy guapo pero tienes que practicar más . yo soy tu fan múmero uno todas mis amiga tambien te quieren . ¿es verdad de que vais a venir a torrevieja ? tomá mi e-mail csri@hotmail.es
Fecha: 2008-02-08 15:47:34
 

cesar de PERU escribió:
jhon cena eres un muchacho super dotado veo todas tus peleas admiro como quieres a tus seres queridos para mi eres lo maximo como super estrella de la lucha libre sigue para adelante y se elo mejor siempre mi correo es cerluis_24@ agregame loco
Fecha: 2008-01-31 11:47:42
 

Adrián escribió:
John Cena es el mejor atleta de todos los tiempos lo adoro como un dios y me gustaria seguir sus pasos y los que digan lo contrario que se saquen la polla de la boca antes de hablar
Fecha: 2008-02-13 09:55:05
 

luis fernndo escribió:
yo opino que jon cena es un gran luchador asi que siga asi por cienpre
Fecha: 2008-01-31 20:31:48
 

blink_chabelos@hotmail.com escribió:
eres lo maximo brother arriba somos lo maximo cena...
Fecha: 2008-02-01 07:51:28
 

roberto vaca escribió:
heres el mejor luchador del mundo y quisiere saber tu msn pasamelo plis tengo todas tus peliculas y tus 5 CD eres mi idolo asta quisiera ser como tu odio a randi orton por que te disloco el braso pero hoy te vi en la tv y le ganaste fasil mente fue el dia 02/02/08 y jamas lo boy a olbidar te dejo mi msn es roberto_vacaryp@hotmail.com agregame para poder ablar y tengo 5 iconos jestuales q ablan de ti jajaja bye te cuidas bye agregame plis aora si bye
Fecha: 2008-02-02 21:25:53
 

edenia escribió:
soy edenia y tu fan 1 te kiero muxo y aver si te pasas un dia por aki wapeton
Fecha: 2008-02-13 12:45:58
 

andrik escribió:
eres el mejor mandame tu correo te e visto en vivo te dejo mi msn andrik.com@hotmal.com se bio chido como ganaste royal rumbla cuidese i dejeme su correo agregeme cuidese bie
Fecha: 2008-02-05 11:40:25
 

carlos escribió:
jhon cena felicitaciones por ganar en royal rumble 2008 agregame en tu e mail elcarlitosrodriguez@hotmail.com
Fecha: 2008-02-05 13:22:17
 

AMAIA escribió:
JOHN CENA T KIR CN LOKURA ERS M AMOR MI IDOL M EROE M VIDA MI FAN N 1 T KIR MAS Q A NADIE NUNCA T OLBIDARE LO MJOR Q M A PASAD N M VIDA LA LOKURA D KERERT TODS M DICEN... Q PSADA CN JOHN CENA Y LS DIGO... PRO SK N PUED PARAR D PNSAR N EL TIO LE L KIERO LE KIERO LE KIERO L KIERO EL EMEIL M L E INBENTAD X SIACAS N OS CONOZKO A NADIE PER SI OS GUSTA JOHN CENA SOIS MAJOS NGA BBSSSS A TODS YOU CAN´T SEE ME 13,12,22,23,54,69 JOHN CENA AND AMAIA TKTKTKTTKTKTKTKTKTK
Fecha: 2008-02-14 03:16:25
 

ale guerra escribió:
john cena te me encantaria conocerte en persona extrañe muxo tu ausencia trato de verte cada sabado en mi pais te kiero muxo mi amante se parese muxo a ti.
Fecha: 2008-02-14 07:54:18
 

DaNieLa escribió:
hola john cen aeres mi super idolo la neta eres el mjor luchador de la wwe te adoro m encanta komo eres asi todo y luchas bn chido plis kiero ablar kontigo soy d colima ok agregame a mi correo ay estas d todas maneras sas adios kuidat y sigue luchando y ganando y recuperat ms ya veras k recuperas el campeonato bye
Fecha: 2008-02-22 15:33:49
 

Eduardo escribió:
John Cena es el mejor, el gamará en No Way Out y reconquistará el tíyulo de la WWE
Fecha: 2008-02-09 21:24:10
 

Eduardo Cadena escribió:
Hola John Cena tu ganarás en No Way Out y reconquistarás el título de la WWE. Soy tu fan #1 agregame a tu correo soy eduardo_dx_95@hotmail.com
Fecha: 2008-02-09 21:36:04
 

estelika escribió:
john cena eres el mejor!! randi orton nop puede kontigo wapo tengo unas ganas k vengas a zaragoza k te kagas bss
Fecha: 2008-02-16 13:45:11
 

karla escribió:
pues yo lo unico que puedo decir de John Cina es de que esta guapo es un super luchador, soy su fan No:1
Fecha: 2008-03-06 16:36:51
 

mary escribió:
simplemente eres un amorrrrrrr en todo el sentido de la palabraaaa
Fecha: 2008-02-22 20:06:07
 

Anika escribió:
John cena es el mejor y a todos los que digais qe toma cosas es mentira,John cena es el ms wapo de la wwe y no imita a nadie por que a el no le hace falta
Fecha: 2008-02-22 23:25:11
 

jenny escribió:
saben yo no creia en el amor hasta que te vi luchar me enamore y no me importa que estes casado o con hijos solo quisiera ser por lo menos una ves tuya sin compromios contestame y te juro que no te arrepentiras nunca
Fecha: 2008-02-23 15:04:56
 

alix escribió:
eres superrrr johnn cena eres lo maximo tkm eres atm...... te admiro
Fecha: 2008-02-20 10:22:56
 

kiara escribió:
eres un amorrrrrrrrrrrrrrrrrr eres el luchador mas lindo , y sencillo ...............te admiro muxooo eres mi amor jajaja kisiera poder comunicarme contigoooo espero tu correo
Fecha: 2008-02-20 17:28:37
 

EVELIN MARTINEZ escribió:
ME ENCANTAN TUS PELICULAS Y TU FORMA DE PELEAR PERO ME GUSTA MAS TU CUERPO JOHN CINA
Fecha: 2008-02-20 17:45:00
 

pepe escribió:
jonh cena eres elmejor pixa pelea mui vien y leencantas amiermana tu cuando peleaste contra el gran kali lovenciste eres el mejor
Fecha: 2008-02-21 05:24:26
 

mick escribió:
esta re lindo ademas de rey misterio te re amo rapero
Fecha: 2008-02-28 08:41:06
 

adriana yadira escribió:
hola john sabes soy super fanatica d la wwe y m fasina como luchas eres el mejor de todos T.Q.1.CH y espero verte en WRESTERMENIA XXIV soy de mexico
Fecha: 2008-02-28 20:05:05
 

karina escribió:
hola mi amor te amo mucho y me gustaria chatear con tigo espero q te conectes t.q.u.ch ok y no les agas caso a las otras chavas y en primer lugar a maria
Fecha: 2008-02-25 19:08:00
 

liz escribió:
hola john cena eres lo mejor y desguañinga a randy orton y hhh te amamos por que no llegas a peru espacialmente a huancayo por que aqui te estamos esperandote con los brazos abiertos te queremos todo el peru esta contigo eres un ejemplo para toda la juventus te amamos de ines y su amiga danitza de huancayo te amamossssssss con tod el alma , corazon ,vida,mente
Fecha: 2008-03-24 13:04:35
 

abel ever misterio escribió:
ke onda cena espero ke estes bien antes ke nada deja me desirte ke eres el mejor luchador dela wwe claro aparte de otros de randy orton batista y triple h ay me los saluda i me gustaria ke me agregars mio msn es mc_kartel_2000@hotmail.com a tambien me saludas a the rock esto es todo amigo y tu rola esta muy chida en serio agregame
Fecha: 2008-02-29 16:22:56
 

ronald ccanto ccanto ccanto escribió:
Que es una persona muy bueno,y es el mejor luchador de la wwe claro aparte de the underteker saludos jhon desearia que me agrages ami msn es ccai_gaiser@hotmail.com
Fecha: 2008-03-01 17:58:28
 

gaci escribió:
john cena eri lo mejor soy de chile eri la raja eri mi idolo gracias john ceeeeeeenaaaaaaaaaaaaaaaaaaaaaaa
Fecha: 2008-03-03 15:40:08
 

eladio escribió:
john cena eres el mejor espero que metas muchas parizas a todos y te doi me msn es eladio_97@hotmail.com
Fecha: 2008-03-09 15:25:58
 

sara escribió:
john cena es el mejor el + guapo el mejor
Fecha: 2008-03-14 15:31:56
 

YERLIN escribió:
hay yohn!! te felicito eres lo mejor nunca cambies
Fecha: 2008-04-08 18:54:05
 

brenda escribió:
jhon cena quitales el champion a randy orton el no sirver el q sirver eres tu ganales para q truifen mucho q es a ti q se te ves ese champion lindo a ti
Fecha: 2008-03-19 20:57:42
 

alberto escribió:
yon cena eres mi jugador favorito en graselmenia 24 le ganaras a raindi orton el tonto por no decir otra cosa mas gorda y triple h el melena chao mejor de we
Fecha: 2008-03-20 07:44:55
 

sheyla marilyn escribió:
john cena el campeom y el rey te amooooooooo
Fecha: 2008-03-21 21:13:54
 

victoria escribió:
hola jon sina eres el mejor para mi eres mi novio te amo lujas muy bien y espero que sienpre seras el mejor por que bautista tan bien luja muy bien pero tu para mi eres el mejor y despues bautista deu wapo te amooooooooooooooooooo
Fecha: 2008-03-22 05:02:57
 

INES H. B. escribió:
JHON QUIERO DECIRTE QUE TE AMO ERES LO MAXIMO ERES EL MEJOR DEL MUNDO TODO EL PERU TE QUIERE Y VISITA MACHU PICCHU MARAVILLA DEL MUNDO TE ESPERAREMOS CON LOS BRAZOS AVIERTOS
Fecha: 2008-03-22 12:30:48
 

bea escribió:
ola mira jonh para mi no eres solo mi idolo si no mi sueño eres lo mejor, el que cada dia hace qu mi vida se alegre solo con pensar en ti porque te quiero y quiero que sepas que espero que seas super feliz eres mi idolo mi sueño mi vida al k yo mas admiro tquieroooooooooooooy nunca en la vida me cansaria de decirtelo ,,,,*****
Fecha: 2008-03-22 17:38:23
 

maria escribió:
jhon cina eres muy bueno me encantas y eres lo mejor de wwe
Fecha: 2008-03-22 19:05:40
 

miriam escribió:
jonh Cena es el mejor¡¡¡ porque es fuerte, inteligente, rápido, buen luchador... y además está BUENISSSIMO. Weno solo decir que es el Nº1 1 BESO
Fecha: 2008-03-23 09:34:14
 

kathy de peru escribió:
john mi nombre es kathy soy de peru ,te escribo para felicitarte porq tu eres un gran luchador eres de los mejores luchadores. sabees pelear muy bien y me encantaria conocerte en persona verte y darte abrasos y besos ,quiero q vengas a peru porq aya te admiran mi sueño es conocerte .john eres honesto y orgulloso asi me gusta te deseo q estees bien y q te cuides ojala q lo leas , acuerdate de mi amigo soy kathy de peru ,q te quiere y te ama bye friends suerte
Fecha: 2008-04-02 18:41:19
 

daniela escribió:
me encantas tu eres el mejor del mundo eres muy lindo no ahi nadien que te iguale tu eres el grande el mejor le puedes ganar a todos eres el mas lindo el mas fuerte lo eres todo soy fans tuya y a todos lo que hablan mal de ti lo dicen x envidia cualquiera quisiera ser como tu
Fecha: 2008-04-11 20:20:45
 

ines escribió:
hola somos de peru y somos fanaticas de raw especialmente de ti john cena eres el mejor del mundo te amamos mucho por que no vienes a peru aperas de q no recuperaste tu titulo en wrestlemania24 te seguimos queriendo muchoooooooooooo sabemos que recuperaras tu titulo por que ese titulo te pertenese y el mequetrefe de randy es un patan que nisiquiera lo merese eres el mejor te amamamos de ines , danitza y crhiz te amooooooooo
Fecha: 2008-04-12 09:24:50
 

genesis escribió:
me encantas como peleas porq siempre le quedas ganando a tus contrincantes espero que dios te bbendiga desde panama tu fanatica genesis un beso atte ggg,.
Fecha: 2008-04-06 12:11:00
 

Josep escribió:
Vamos Jon tu puedes gana a todos y hasre el Campeon de la wwe eres el mejor como te qeremos todos en ESPAÑA. SUERTE ADIOS.
Fecha: 2008-04-13 10:30:55
 

Comentarista escribió:
Considero que el luchador en mención, es una persona, que tiene una profesión, el se dedica a lo que le gusta, y por lo visto lo desarrolla muy bien. Ademas no somos moneditas de oro para caerle bien a todo mundo. Es una persona que se ha podido desenvolver en varios ambitos, consiguiendo exito. Acerca, de que si es una persona que se droga, considero que en vez de criticar, deberias aportar un consejo, para que no siga consumiendo drogas. Mi percepción, es que es una persona sana. Las personas tenemos la facilidad de criticar, pero cuidado, porque podemos tener una adiccón, no precisamente drogas, hay otras adicciones, que afectan nuestra salud mental, fisica y humana.
Fecha: 2008-05-09 10:21:24
 

nayeli escribió:
john cena eres el mejor de toda la historia i mimejor sueño es conocerte i te amo mucho i quisiera tu coorreo el mio es fresa85@live.com.mx bai bai
Fecha: 2008-04-15 16:24:52
 

lidia_laxula_1994 escribió:
ola john eres el mejor sigue asi y no cambies nunca a por el titulo de la wwe arriba campeon no te rindas nunca TQMMMMMMM!!!
Fecha: 2008-05-03 05:44:37
 

rosmeri escribió:
holas john cena mi nombre es rosmeri soy tu famatica numero uno eres el mejor de lucha libre o de wwe soy del peru y tengo a una compañera que la quiero tanto como una amiga ella es fanatica super de ti y en vuestro salon somos las que hablamos de john cena eres el mejor nunca cambies y espero conocerte en person bye te manda besos casandra y rosmeri.
Fecha: 2008-04-17 17:45:59
 

SMITHgarcia mendes escribió:
john cena es el mejor de todos los luchadores de todo el mundo y el mas guapo de los guapos ademas es elmas papacito de todos y con unos ojitos cautivadores y una carita de angel que no se iguala a NADIE CHAU BESOS
Fecha: 2008-04-17 21:13:04
 

roberto escribió:
jhon cena se merece mucho mas el titulo de la wwe que randi orton por que jhon cena es el megor y por eso se lo merece
Fecha: 2008-04-19 06:25:07
 

LIDIA escribió:
JOHN CENA eres el mejor seguro que vas a ganar backlas ya se que todo lo que yo te digo te lo dice tambien muchisimas chicas pero esque no paro de penar en ti todo el dia no se lo que me pasa mi madre dice que estoy loca porque m egusta un hombre 17 años mayor que yo es un tonteria, verdad? y creo que es verdad lo que dice mi madre me etoy volviendo loca por ti bueno si alguna vez lees esto solo quiero que sepas que TE QUIERO MUCHO Y QUE SUEÑO CON VERTE ABRAZARTE Y ABLAR CON TIGO TQM espero conocerte algun dia por que yo siempre he confiado en ti incluso cuando estabas lesionado que sepas que yo lloraba un monto viendo las imagenes de tu operacion no podia soportarlo ahhh!! y otra cosa no agas caso de todos esos idiotas que creen que no eres el mejor y que no vales nada por que como yo digo "la envidia es muy mala" y todo eso que dicen de ti que eres gay y todo eso es mentira mentira y todo mentira bueno ya me despido con un besote muy grande y que te quiero mucho ¡ojala te conozca algun dia por que yo siempre estare aqui esperandote y viendote por television tqm un besito adios TE QUIERO MUCHO
Fecha: 2008-04-26 03:25:33
 

damaris rios arroyo escribió:
TE AMO JOHN CINA SOY UNA DE TUS SUPER FANS YO BOY AIR EL 23 DE MAYO A BERTE.QUIERES SER MI MEJOR AMIGO JOHN CINA
Fecha: 2008-04-19 21:39:17
 

CRISTHIAN escribió:
jhon cena eres mi luchador faborito espero algun dia ser parte tambien dela WWE COMO TU MI MAS GRANDE SUÑO ES ESE ,ERES EL MASFUERTE ,PERO NO PUEDO CREER Q PERDER EN WRESTALMANIA
Fecha: 2008-04-25 19:39:35
 

ELISA escribió:
jhon cena eres el mejor en eso no ay duda y aparte eres el hombre mas guapo como me gustaria conocerte soy tu fan como me gustaria algun dia platicar contigo pero que lastima que no se baya poder de todos modos como dice el dicho la esperanza muere al ultimo ESPERO TU CORREO T.Q.R. JHON ERES MI VIDA
Fecha: 2008-04-25 21:01:32
 

LIDIA JOHN TE QUIERO MUCHO escribió:
john cena eres el mejor te quiero mucho sigue asi no cambies nunca seguro que vas a ganar backlas espero conocerte abrazarte y ablar con tigo algun dia TE QUIERO MUCHO MUCHO MUCHO MUCHISIMOOOO!!!!! ojala puedas contactar con migo!! lidia_laxula_1994@hotmail.com
Fecha: 2008-04-26 03:35:21
 

lidia john te quiero mucho escribió:
john cena no pasa nada por que hayas perido backash seguro que vas a tener muhisimas mas oportunidades para volver a consegui tu titulo no te rindas nunca sigue asi y veras que lo vas a conseguir tqm
Fecha: 2008-04-28 09:05:36
 

maria escribió:
es el mejor y mi amigo fran es su fan numero 1 jeje
Fecha: 2008-04-30 12:00:53
 

thalia escribió:
jhon cena es un papasito el debe ser el campeon duela a quien le duela
Fecha: 2008-05-05 16:09:48
 

lidia_laxula_1994 escribió:
ola john cena me encantaria escribirte todos los dias pero por desgracia no puedo porque estoy todo el dia estudiando para aprobar todas las asignaturas en fin de curso y mi madre me deje ir a verte a malaga y a si que siempre que tengo un ratito te escribo por que te quiero mucho y siempre deseo que llege el fin de semana para verte TQM BSSSSSSS
Fecha: 2008-05-01 09:55:33
 

lidia_laxula_1994 escribió:
hola john, como estas? espero que bien solo que eres el mejor y que sin verte no podria vivir me tengo que ir BAII!!!! TQM!!!!! KISSSSS!!!
Fecha: 2008-05-05 08:43:33
 

yaritza escribió:
jhon cena es lo mejor que tiene la wwe es lo mas lindo simpatico sexy.........es lo maximo
Fecha: 2008-05-07 10:50:50
 

lidia_laxula_1994 escribió:
ola!!!! john porfavor contacta con migo necesito hablar con tigo TQM BSS.......!!!!!
Fecha: 2008-05-07 15:01:39
 

penelope escribió:
el es lo mas bello de la wwe
Fecha: 2008-05-08 09:07:33
 

jenniffer marie escribió:
hola jonh cena es lo mejor y nunca lo de jare de apoyar y el esta buenisimoooooooo
Fecha: 2008-06-01 12:53:28
 

jon ander escribió:
hola john cena soy tu fans numero 1 vivo en españa y tengo 11 años me gustaria que me escribieras cuando lo leas un beso jon ander a si sipeleas contra randi orton yo te animare a ti
Fecha: 2008-05-14 15:15:15
 

jon ander escribió:
hola john cena soy tu fans numero 1 vivo en españa y tengo 11 años me gustaria que me escribieras cuando lo leas un beso jon ander a si sipeleas contra randi orton yo te animare a ti
Fecha: 2008-05-14 15:42:40
 

jon ander escribió:
quetal john cena escriveme cuando puedas y te quiero decir que no te rindas nunca porque tarde o temprano tu cinturon favorito volvera a ser tuyo proponle un conbate atriple h por el cinturon de la wwe chao y recuerda escriveme suerte
Fecha: 2008-05-15 13:45:24
 

adrian escribió:
sera que john cena puedo venir a santa cruz de bolivia pa q me pelee con el caraj... qu tengo ganas de pelear con el por q no me va ha hacer nada ok q venga si es hombresito
Fecha: 2008-05-31 19:45:19
 

yerimi escribió:
hola john espero que te encuentres bien soy tu fans numero 1 no tengo otro luchador preferido mas que tu y no te cambiaria por otro luchador porq para mi eres el mejor y sigue hechandole ganas no te dejes vencer por malos comentarios espero que me puedas escribir seria un sueño hecho en realidad yo se que tu eres bueno de corazon y podrias ser mi sueño en realidad y poder ser amigos para poder platicar claro si hablas en español hasta decirte que tengo todas tus luchas,dos playeras,un cuadro y un poster tuyo, pero espero algun dia conocerte y puedas leer este mensaje te mando besos y abrasos y cuidate mucho bay
Fecha: 2008-05-12 15:57:35
 

aitor escribió:
como se puede mandar esta foto a un amigo mio
Fecha: 2008-05-16 13:44:06
 

GISSELLE escribió:
HI, JONH CENA TE DESEO LO MEJOR TE ESCRIBO DE HONDURAS TE CONSIDERO UN EXCELENTE LUCHADOR AUNQUE ESTAN UN POCO LOCOS PERO TODA LOCURA TIENE UNA RAZON CIUDATE QUE DIOS TE BENDIGA Y TE DE UNA BUENA ESPOSA
Fecha: 2008-05-16 21:25:59
 

lidia_laxula_1994 escribió:
ola john siento mucho no aberte escrito antes he estado muy ocupada con examenes bueno solo decirte que estubiste super bien diciendole a willian regal todo eso alguien tenia que decirselo solo felizitart por eso ojala leas todos los mensajes que te mando por que me haria mucha ilusion y mas ilusion me haria que me contestaras alguna vez por que como al igual que otros muchos fans tuyos para mi tambien seria un sueño hecho realidad me voy xau bss cuidate!!!TQM
Fecha: 2008-05-17 11:43:06
 

sole escribió:
jhon cena es un buen luchador, ademas su experiencia y tu trayectoria en otras carreras como actor, cantante y luchador es un buen personaje. y me encanta ademas en guapo, me gustaria saber si es casado o si tiene novia??.
Fecha: 2008-06-17 16:06:06
 

antonio gonzales estebanes escribió:
JOHN CENA ERES EL MEJOR PERO DEJAME DECIRTE QUE QUIEN ES MUCHO MEJER EL EL UNDERTAKER Y NO TE METAS CON EL PORQUE TE VE A MANDAR A QUE TO REST IN PEACE
Fecha: 2008-05-19 20:56:03
 

yusvina escribió:
sabes solamente te escribo para pedirte tu correo y si me puedes contestarme te lo pido porfis no seas malo ya y me gustas un monton cuando peleas nada mas bueno te deseo mucha suerte.y cuidate un monton yo se q Dios te apoyara.
Fecha: 2008-05-20 16:16:45
 

Patricitaa escribió:
Hola JoHN CeNa ke sepas k eres lo mejor de la WWE y k siempre te apoyo en todos los kombates y k bien kedaste en explikarle eso en willian regal lo dejaste en su sitio y tu kedaste de maravilla eres un hombre..encantador tienes unos ojos k dan gloria mirarlos te kiero mucho!! me welves loka!! eres un bombon!! estas mas weno k el almendro!! ojala tuviese mas años para poder kasarme kontigo...uy k korte k werguensa jeje enseñales k eres el uniko kampeon de la WWE RAW!! se k puedes aserlo xk konfio en ti!! k te adoro!! te amo!! solo kiero lo mejor para ti a felisidad amor a todo!! t kiero!! kuidate muchos besitos!! [Te KieRo[~>JoHN_CeNa
Fecha: 2008-05-20 17:26:27
 

Patricitaa escribió:
y si tienes correo o messenger k es lo mismo agrega x favor laratchet@hotmail.com t kiero!!!!!!!!!!
Fecha: 2008-05-20 17:28:22
 

rodry escribió:
ola JOHN CENA ESPERO Q GANES EN TODAS TUS LUCHAS MANDAME TU CORREO EL MIO ES royca_09@hotmail.com
Fecha: 2008-05-20 18:09:30
 

joakin escribió:
john cena animo amigo soi tu idolo estoy desendo conocerte por ke luchas de lujo tio derrota al triple h para ke seas el campeon de la wwe tu pelicula es la mejor me guta muxo un saludo marinero john cena jajajaaj adios amigo suerte por cierto agrega mi msn joakin_betico_15@hotmail.com john ese es mi msn
Fecha: 2008-06-13 10:35:56
 

Jans Elvest escribió:
John Cena 100pre sera el mejor luchador (gladiador) d la wwe d la historia "El RaperO JanS CENA!...
Fecha: 2008-05-21 21:05:14
 

erick amaya lujan escribió:
eres muy fuertes y quiero q pele es con andiorton
Fecha: 2008-05-22 17:05:35
 

benjamin ygnacio echeverria maulen escribió:
ereselmejor qeandiorton qe triplex tu eres el mejor elbatistatiene ojos de abeja concariño nachi_-cena
Fecha: 2008-05-23 11:43:16
 

marina escribió:
ffsiento decepcionaros pero cena esta casado con una piva k se llama liz o algo asi.pero quien quiera defenderle que se apunte a yahoo!respuestas,al foro de lucha libre y se una a los pro-cenas.besotes a todo john cena forever es lo maximo!!!!esta mas bueno el chocolate...pero aki la peña se le va la pinza,para k dejais el msn??en seiio kreeis minimamente k john cena os va a escribir???k fe dios mio....john cena still the champ
Fecha: 2008-05-30 09:13:25
 

JULISSA escribió:
HO0OLA**JOHNCENA**OJALA**Y*KE*LEAS**MIS**MENSAJES**O0OK**YY**SI**TIENES **CORREO AGREGAME** PORFAVOR **KIERO **PLATICAR** COO0NTIGOO0O0** Y* NO** SE** ME** EMOCIONO** MUSHO **CUANDO** SALES** A **PELEAR Y** ESPERO KE **SI ME* ESCRIBAS ** Y* TE DESEO **MUSHA SUERTE*** PARA KE *GANES Y GANES* CANPENATOS 0OO0K **TKMMM Y YO TENGO **FE KE UN DIA** BAS A GANAR **A HHH EL** TITULO **O0O0K ***BYE** TE **CUIDAS **TKMMM**
Fecha: 2008-07-16 19:04:53
 

brenda yazmin escribió:
la verdad JONH CENA es el mejor le pese a quien le pese Jonh cena te quiero mucho te deceo lo mejor besos
Fecha: 2008-07-10 21:19:30
 

DORIS escribió:
yo creo k john cina es genial y que me duele mucho que se valla a casar
Fecha: 2008-05-26 17:44:46
 

Patricitaa escribió:
y kon kien te casas JoHN_CeNa? DORIS ami tb me doleria muchisimo k se kasara!!!:( esk john cena!! te kiero mucho komo para dejarte iir!! te kierooooooooooooo
Fecha: 2008-05-26 18:10:57
 

lidia_laxula_1994 escribió:
hola jonh sabes una cosa creo que voi a aprobar todas las asignaturas para fin de curso aqui solo quedan ya dos semanas y si las apruebo todas podre ir a verte a malaga por favor no me falles mucha gente dice que no vas a venir y que estoi perdiendo el tiempo pero a mi me da igual lo que diga la gente por favor tienes que venir mi sueño es verte en pesona me harias la persona mas feliz del mundo ojala leas esto muchos KISS TQM.....I LOVE YOU 4 EVER
Fecha: 2008-06-02 10:05:08
 

JULISSA escribió:
HO0OLA JOHN CENA ERES EL MEJOR DE LA WWE Y EL MAS GUAPO MIS HERMANOS Y YO SIEMPRE BEMOS LAS LUCHAS Y ME EMOCIONO MUCHO CUANDO SALES TE DESEO SUERTE Y SIGUE GANANDO A LOS DEMAS O0O0K TKMM:TE KIERO MUCHO MUCHO O0OO0K CUIDATE ESPERO KE NO ESTES COMPROMETIDO JAJA O0O0K CUIDATE Y TKMM
Fecha: 2008-07-15 23:02:24
 

pamela escribió:
hola! yo pienso que jOhn cena esta guapo, pero tengo una duda quisiera saber si esta casado? muchos dicen que si otros dicen que no la verdad no lo se pero si quisiera saber si esta casado o si tiene novia? ok bye ♥
Fecha: 2008-07-12 15:09:59
 

yaneth escribió:
hola john cena te adoro q bueno q ya vienes para peru pa verte luchar q vacan va estar te juro q voy a ir no me importa pagar los 930
Fecha: 2008-06-04 11:20:19
 

mary escribió:
hola ps solo les quiero decir que yo me considero una gran fanatica de john cena tengo toda la pared de mi cuarto con fotos de el quisiera verlo y decirle que es mi amor platonico nunca lo dejare de ver es un triple papasito y esta con la cultura del rap como yo.. te quiero the chaing soldier y por favor si algun dia llegas a leer este msj esperame y no te cases que estoy ahorrando para irme a estados unidos a verte aunque sea desde lejos mi satisfaccion es esa veo todas tus luchas tengo tus pelis y porfavor sigue asi que asi nadie te quiera yo siempre sere tu fanatica hasta la muerte recuerda que te amooooooooooooo att mary de cena
Fecha: 2008-06-15 16:21:22
 

mary escribió:
hola ps solo les quiero decir que yo me considero una gran fanatica de john cena tengo toda la pared de mi cuarto con fotos de el quisiera verlo y decirle que es mi amor platonico nunca lo dejare de ver es un triple papasito y esta con la cultura del rap como yo.. te quiero the chaing soldier y por favor si algun dia llegas a leer este msj esperame y no te cases que estoy ahorrando para irme a estados unidos a verte aunque sea desde lejos mi satisfaccion es esa veo todas tus luchas tengo tus pelis y porfavor sigue asi que asi nadie te quiera yo siempre sere tu fanatica hasta la muerte recuerda que te amooooooooooooo att mary de cena hhaaaa y por si quieres visitarme soy de bogota colombia
Fecha: 2008-06-15 16:22:53
 

lidia_laxula_1994 escribió:
ola john sabes creo que si que voi a poder ir a verte por lo pronto mis padres me ha dejado ir a isla magica un parque de atracciones que hay en la provincia de sevilla estoy super contenta ojala me dejen ir a verte a ti tambien XAU BSS TQM escribeme
Fecha: 2008-06-07 11:20:46
 

oscar escribió:
hola jhon cena eres mi favorito por que peleas muy bien y me gusta que seas rapero a lo mejor en julio o en agosto voy a verte eres el mejor de pressing cath escribeme jhon cena y dame tu messenger
Fecha: 2008-06-09 07:19:19
 

carla escribió:
jonh eres muy lindo te amo
Fecha: 2008-06-10 13:45:20
 

BRIAN escribió:
ES MI FABORITO ES EL MEJOR CHAOOOOO
Fecha: 2008-06-16 08:53:32
 

carolin jimenez escribió:
diablo papi tu si estas bueno te kiero para mi solita perdon llo soi derepublica dominicana mi nombre es carolin jhon cina es un joben mui lindo y mui fuerte bueno eso eratodo bayyyy
Fecha: 2008-06-17 18:11:13
 

lina osorio escribió:
hola jhon cena soy fanatica numero 1 de ti mi amor me puedes escribir
Fecha: 2008-07-16 22:55:29
 

lina osorio escribió:
hola jhon cena soy fanatica numero 1 de ti mi amor me puedes escribir
Fecha: 2008-07-16 22:55:31
 

yuhary escribió:
hola papi te escribo desde venezuela eres mi luchador numero 1 de la wwe. no estas mas bueno papi por que no puedes me gustaria conocerte sigue haci y ponte cada dia mejor chauuuu papiiiii bellooooooooooooooooo
Fecha: 2008-06-29 14:08:51
 

Patricitaa escribió:
wenas john cena wenos dias k tal estas? pos espero k estes muu bien y aunk no allas ganao el nigh of champions k sepas k para eres el mejor y k tu fuiste el gran ganador de ese kombate y trankilo ya se lo ganaras otro dia lo importante ahora esk te recuperes de esos golpes y weno cuando sea mayor me ire a estados unidos y ire west newbury aver si te veo me encantas yo te adoro te amoo tu si eres mi verdadero amor ^^ adios john cena me pasare mas a menudo besitos mii amor
Fecha: 2008-07-01 03:43:03
 

Einstein escribió:
yo soy tu fanatico
Fecha: 2008-07-03 20:55:03
 

Paula Gonzales escribió:
Siempre te veo eres un super luchador y espero k siguas asi, pues te deseo mucha suerte y sigue adelante BENDICIONES...!!!
Fecha: 2008-07-17 17:02:42
 

david escribió:
John eres el mejor de todos y me gusta mucho tu forma de luxa soi un fanatico tuyo tengo todas tus cosas gorras camisetas etc. soi d Motril y espero poder conocert algun dia, sigue asi y no cambies.
Fecha: 2008-07-12 04:12:31
 

gisela escribió:
eres el mejor de ese praograma
Fecha: 2008-07-12 09:59:43
 

henry castellanos jimenez escribió:
hola john eres y seguiras si4endo mi luchador ojal y nunk djeds de ser vel mismo
Fecha: 2008-07-05 11:37:32
 

BRIAN escribió:
hola jhon cina soy tu fan soy de chile eres el mejor de los lucha dores chaooo
Fecha: 2008-07-13 11:39:36
 

BRYAN escribió:
hola jhon cina soy de peru te felicito por ser un luchador de wwe . me embias tu messenger a mi correo chau campeon
Fecha: 2008-07-05 16:04:32
 

ingrid escribió:
JONH ERES EL MEJOR MIS HERMANOS Y YO SIEMPRE VEMOS LAS LUCHAS ERES EL MEJOR Y QUE TE VAYA BIEN ERES EL MEJOR
Fecha: 2008-07-13 16:21:18
 

DORA MARIA escribió:
eres el mejor de todos sigue asi y nadien te va a ganar te quiero mucho eres el numero uno de todos besos cuidate mucho.
Fecha: 2008-07-06 11:29:47
 

agusto escribió:
hola quiero saver el meil de john cena y cuando lo agrege que no me borre
Fecha: 2008-07-20 08:57:42
 

ADRIAN escribió:
OLA AMI TAMBIEN ME GUSTA JOHN CENA Y LA VERDAD LO KIERO COMO UN ERMANO YO SOY DE MEXICO JOHN CENA YOU FORCE IN EEUU
Fecha: 2008-08-04 20:45:12
 

ANA LAURA escribió:
JON CENA YO TE ADMIRO Y TE RESPETOO THU ERES DE LOS LUCHADORES KE ADMIROO TE KIEROOO Y SIGUE TRIUNFANDOOO
Fecha: 2008-08-08 14:45:50
 

SHAKIRA escribió:
JHONNY LA FUERZA DE UN GRAN GUERRERO DE UN GRAN LUCHADOR NO ESTA EN SUS BRAZOS SINO EN LA NOBLEZA DE SUS ACTOS........SHAKIRA PARA MI ERES UN BELLO SER CON TODOS TUS VIRTUDESY DEFECTOS BESOS
Fecha: 2008-07-21 15:44:26
 

jessica escribió:
te amo jhonny
Fecha: 2008-07-21 17:45:59
 

NOELIA escribió:
JONH CENA ERES EL MEJOR JUGADOR DE LA WWE NECESITO TU MESSENGER SOY TU FAN NUMERO UNO ABER CUANDO VIENES ATENERIFE QUIENTENGA SU MESSENGER O QUIERA HABLAR CON MIGO AGREGENMEN NO IMPORTA SIN SON CHICOS O CHICAS.XAO UN BESO A TODAS Y A TODOS
Fecha: 2008-08-20 11:41:40
 

zitlali escribió:
estas como quieres papucho...y me alegra q no estes casado espero q sigas asi.. y los q no esten de acuerdo es xq son unos envidiosos... me encanta tu personalidad y la energia q proyectas x eso te amo!! SALUDOS DESDE MEXICO D.F. deverias de venir mas seguido a mexico te amamos!!! bye!!! i love you!!
Fecha: 2008-07-24 01:58:12
 

jennifer escribió:
PS SOLAMENTE KIERO DECIR Q JOHN CENA ESTAS SUPER GUAPO TE AMO 1 CH Y PS QUIERO SABER TU E-MAIL PARA PODER ESTAR EN CONTACTO TE AMO MUCHO Y NUNK OLVIDES KE TU ERES EL MEJOR EL NUMERO 1
Fecha: 2008-07-25 17:34:02
 

patricia escribió:
Ola soy patricia y me encanta john cena y todas aqelllas persona q dcen q es drogadicto mas drogaos estais vosotros y aqien le guste el pressign catch q me agrega por favor: patri_4_mikel@hotmail.com ARRIBA LA WWE!!!! una pregunta alguien sabe si vendran a barcelona? alguien sabe si el john cenatiene novia= besoss bye
Fecha: 2008-07-27 16:17:01
 

caty escribió:
jonh cena es muy guapo muy fuerte y muy baliente te quiero¡¡¡¡ eres mi fan numero 1 haber si me mandas un correo y una foto tulla te kiero mucho¡¡¡¡¡ yonh cena es el mejor luchador de wwe????
Fecha: 2008-08-20 14:10:15
 

sebastian escribió:
hola jhon cena soy un fan numero 1 tengo tus polos yo soy de peru tambien tengo tu jigantografia tuya eres el mejor de todos los luchadores
Fecha: 2008-08-20 16:38:27
 

SEBASTIAN CASTAÑEDA escribió:
HOLA JHON,QUERIA DECIRTE QUE A LA VERDAD ERES UN GRAN LUCHADOR, Y NADIE TE PUEDE GANAR ME ENCANTARIA QUE ME CONTESTES O ME MANDES ALGUN POSTER DE TU MEJOR LUCHA. ATTE TU HINCHA N° 1 SEPI( 8 años)
Fecha: 2008-08-20 16:45:58
 

ruth escribió:
hola soy fanatica de john cina soy dominicana y si alquien sabe su correo eletronico por favor enviemelo adios vesos
Fecha: 2008-08-03 09:58:38
 

shirley karina escribió:
hola soy archi fanatica de cena cena no seas malito y danos tu correo
Fecha: 2008-08-14 18:28:43
 

joaquin escribió:
hola eres el mas bkn de todo wwe
Fecha: 2008-08-14 21:46:53
 

joaquin escribió:
hola eres el mas bkn de todo wwe me das tu correo
Fecha: 2008-08-14 21:53:02
 

Paula i love john escribió:
Hola soy Paula de Tenerife una de las Islas Canarias de España John Cena eres el mejor no cambies nunca te queremos un monton y yo siempre te apoyare ah,eres el mas guapo del mundo!!
Fecha: 2008-08-16 06:07:32
 

marta escribió:
eres el chico mas guapo que eh visto en toda mi vida,luchas genial y tienes una cara de bueno....
Fecha: 2008-08-22 01:29:31
 

Paula_John_Cena escribió:
JOHN CENA TE QUIERO UN MONTON DAME TU CORREO EN ESPAÑA SOY TU FAN NUMERO 1 VEN A LAS ISLAS CANARIAS ALGUN DIA POR FAVOR ERES EL MEJOR DE LA WWE!!!
Fecha: 2008-08-17 05:17:12
 

Paula escribió:
JOHN CENA TIENES LOS OJOS MAS BONITOS DEL MUNDO Y TU FORMA DE LUCHAR,TU CARISMA Y UN MILLON DE COSAS MAS TE HACEN UNICO E IRREPETIBLE SOY TU FAN NUMERO 1 DE TODA ESPAÑA ERES EL MEJOR DE LA WWE DALE UNA PALIZA AL TONTO DE BATISTA Y ARREBATALE EL TITULO A EL PIRADO DE CM PUNK TE DOY UN CONSEJO,PONTE EL PELO DE PUNTA O DE CRESTA ASI LLAMARAS LA ATENCION DE UN MONTON DE FANS O AL MENOS A MI POR FAVOR ESCRIBE ME A MI CORREO O DAME EL TUYO POR QUE YO Y MUCHOS FANS TUYOS TE APOYAMOS TODOS LOS DIAS Y A TODAS HORAS A SE ME OLVIDAVA LO MAS IMPORTANTE,TE QUIEROOOOOOO!!!
Fecha: 2008-08-19 06:00:40
 

ricardo escribió:
john cena metete a mi mesenger
Fecha: 2008-08-24 12:04:01
 

carla escribió:
john cena es el mejor lchador que hay en raw a pesar de que esta retirado por su accodente que tuvo en la pelea con batista. Es la mejor estrella que existe. Todo quien opin lo mismo que me agregue a su correo
Fecha: 2008-09-08 19:26:33
 

RICARDO escribió:
E SIENTO MUCHO LO Q TE PASO EN EL HOSPITAL UUUUUUUUUUUU TODOS NO SABEN NADA MAS JOHN CENA ARRIBA CENA
Fecha: 2008-09-02 14:38:36
 

jessica escribió:
jon cina eres el MJOR luchador desearia algundia yraverte lucar ami no me importa que hayas perdido para mi tu eres mi idolo espero que me puedas enviar algunasfotos tu yas te quiero mucha ...vay
Fecha: 2008-09-05 15:06:54
 

mada escribió:
john cena es el m ejor de todos y ademas es muuuuuuuy wapo y no tiene nada de esteroides lo k pasa esk os da rabia xk el es muy wapo y se ve suuuper bn.Tiene unos ojos muy bonitos tmb TEE KIEROOOO MUXO WAPETON UN BESOOO TKM
Fecha: 2008-08-27 11:09:52
 

lizbeth castillo glz escribió:
JOHN CENA ERES EL MAS GUAPO DE LA FAS DE LA TIERRA ERES EL No 1 ME GUSTARIA ALGUN DIA CONOCERTE LAS MEXICANAS TE AMAMOS
Fecha: 2008-09-03 20:21:59
 

leidy escribió:
hola jhon solo keria mandarte un mega saludo y keria decirte que eres el mejor y la verdad yo pienso que los macuarritos q escriben cosas malas de ti es xq te tienen envidia y esq ya kisierantener el cuerpo q tu tienes bueno eo es todo y neto tu eres el mejor saludos a todas y todos los fans de jonh cena
Fecha: 2008-09-10 13:10:45
 

bianca escribió:
quiero que me escriba john cena es el mas guapo y el mejor de wwe yo querria que le viera en verdad. adio y aver si me envia algo john porfa¡
Fecha: 2008-09-16 08:54:18
 

CAMILO escribió:
john eres el no 1 mi idolo ojala te recuperes pronto
Fecha: 2008-09-14 20:00:15
 

eduardo montezuma panamá escribió:
ciempre te he acmirado eres uno de mis hidolo pero me gustaria de corazón conocerte pero creo que no se puede espero que tengas exito en tu carrera cuidate eres el mejor.
Fecha: 2008-09-19 14:20:02
 

vicente nicolas escribió:
JOHON Y MATTHARDY SON LOMEJOR ATANGANAAA EL MEJOR DE TODOS ES JHON CENA
Fecha: 2008-10-05 11:14:10
 

mirtha escribió:
hola john cena soy tu fans numero 1 te admiro y siempre se que vas a ganar en las peleas
Fecha: 2008-10-01 16:54:45
 

LORETO ALEJANDRO GARCIA RANGEL escribió:
ers el numero 1 peleas super eres mi idolo y te admiro y tengas suerte en tus peleas yose que por que te fracturaste no pudiste pelear en unforgiven bueno ojala te recuperes pronto te mando un mega saludote adios
Fecha: 2008-09-25 14:44:29
 

Carla Alejandra Heredia Sandoval escribió:
JOHN CENA es el mejor de raw y es lindisimo y todos los que lo critican es porque le tienen envidia por sus ojos bellos que tiene y porque saben que el pelea bien y es muy bueno para la lucha a parte sus canciones son lo maximo y a esos ridiculos que lo critican es porque ellos no saben apreciar el oro.
Fecha: 2008-10-02 19:08:43
 

Raul estrada escribió:
Jonh es una grsndiosa superestrella y mi hermana pregunta ¿Jonh Estas casado?
Fecha: 2008-10-03 16:33:13
 

camilo escribió:
John Cena dame tu messenger xfa
Fecha: 2008-10-11 21:08:29
 

patricia judith escribió:
me encantas estas super hermoso peleas super bien TE AMOOOOOOOOOOOO ERES MY HERMOSO JOHN.
Fecha: 2008-10-12 18:42:56
 

YARLI escribió:
AMOOOOOOOOOO A CENA ES MI UDOLO NUMERO # 1 Y NADIE LE LLEGA A LOS TALONES PORQUE ES ELMEGOR DE LA WWE
Fecha: 2008-10-14 23:51:25
 

URIEL escribió:
JOHN CENA ERES EL MEJOR Y REGRESA PRONTO A LA WWE PARA QUE CALLAS A TODOS.
Fecha: 2008-10-15 20:20:46
 

carolina escribió:
JOHN PARA MI ERES EL MEJOR Y EL UNICO LUCHADOR JUSTO K HAY EN LA WWE,SOY VENEZOLANA Y PIENSO K DEVERIAS RESPONDERLES A TODAS TUS FAN X QUE ESA SERIA NUESTRA RECONPESA A QUI EN VENEZUELA TE AMAMOS Y YO EN ES PESIL BESOS BEBE Y NO NOS FAYES.
Fecha: 2008-10-17 15:28:34
 

ceni escribió:
john is el mejor es lo mas lindo del mundo sin el la lucha libre no seria tan grandiosa i love much john you eres el hombre mas lindo ke hay en la fas de la tierra te amoooooooooooooo
Fecha: 2008-10-17 15:47:22
 

sharon valerie miguel ramirez escribió:
quisiera que john cena me mandara un correo es el mejor y me vale quien opine lo contrario quiero que sepan que me he enamorado de el apesar de que yo tambien soy rapera y me gustaria casarme con el a un que me duplique la edad lo admiro mandame un correo john cena tengo hasta tu pelicula de my life mi direccion es sharon.12_1994@hotmail.com
Fecha: 2008-10-20 13:23:51
 

edinson campos esteves escribió:
que tu eres el mejor del mundo.
Fecha: 2008-10-22 20:33:32
 

sharon valerie escribió:
sharonjohn cena eres el mejor y lo sabes diario veo tus videos y espero que te alivies pronto y desde mexico te deseo las mejores bendiciones a mi tambien me gustan los carros pero especialmente laS CAMIONETAS como las lincon me encantan cuidate y mandame un mensaje anteriormente te puse mi correo
Fecha: 2008-10-20 15:42:04
 

sharon escribió:
JOHN CENA MI MAYOR ANHELO ES CONOCERTE SUERTE ERES UNICO
Fecha: 2008-10-20 15:52:06
 

imanol escribió:
ola john cena esres mi preferido cual es tu msn dimelo plis pfa tqm.
Fecha: 2008-10-19 09:50:11
 

john fredy escribió:
john cena eres el mejor luchador y actor , me gustaria saber como se llama la cancion que utilizas al entrar al cuadrilatero
Fecha: 2008-10-27 10:20:07
 

daniel escribió:
cena sos el mejor de la asociasion de lucha y vas a ser el campeon auque a mucho no le guste
Fecha: 2008-10-27 12:49:15
 

daniel escribió:
cena sos el mejor de la asociasion de lucha y vas a ser el campeon auque a mucho no le guste
Fecha: 2008-10-27 12:49:53
 

Jaume escribió:
a mi John no me gusta en absoltuo, es mas lo odio, soy un anti-cena. este tio , solo save hablar, hablar i hablar, i vender camisetes como mucho, pero no save luchar! es la pura verdad, es un mimado d Vince. pokr gano el ROyal Rumble, pork salio ultimo, ASI ASTA HORSWAGGLE SEÑORES! prefiero a SANTINO MARELLA, que a John Cena! i si kieren un talento joven, esta Randy Orton, CM Punk, Kofi Kingston, Primo Colon. etc... i todos esos superan d mucho a John Cena en todos los sentidos PRO-ORTON ANTI-CENA
Fecha: 2008-10-28 16:36:20
 

pedro sierra escribió:
yo no ze per0o john cena ez el mejor de la wwe aperte de zer aktor y rapero ez un luchador muuy buueenaa hoondaa john cena ez el mejor de todoz y lo zeguira haziendo tu puedez campeon
Fecha: 2008-10-28 14:51:12
 

JAZLENY escribió:
ERES EL MEJOR DE LA WWE Y ESTAS SUPER GUAP000OO NADIE KOMO TU .......PARA MY ERES Y SERAS EL KAMPION.
Fecha: 2008-11-01 15:01:06
 

kari castillo the best escribió:
HOLA SOY KARI LES ESCRIBO PARA DECIRLES QUE AMO A JOHN CENA ES DE LOS MEJORES Y ADEMAS ES GUAPO Y Q NO AGA CASO A LOS CELOSOS Q NO TIENEN ESE CUERPO.. ADEMAS ERES MUY LINDO EN TU FORMA DE SER.. GRASIAS POR EXCISTIR.. TE AMO.. ME KIERO CASAR CONTIGO
Fecha: 2008-11-05 11:58:26
 

neto escribió:
eres el mejor
Fecha: 2008-11-11 18:25:45
 

damian escribió:
sos un crac ojala q vuevas pronto de puerto santa cruz argentina damian y seba
Fecha: 2008-11-08 15:02:58
 

fatima...xd escribió:
JOHN CENA ES EL MEJOR DE LA WWE Y ESPERO QUE VENGAS A EL SALVADOR Y QUE SURVIVOR LE GANE A CHRIS JERICHO EL TITULO DEL PESO PESADO
Fecha: 2008-11-14 18:13:11
 

kari escribió:
sos el mejor regesa a mexico pronto
Fecha: 2008-11-12 15:57:13
 

Paula_john cena_Chris Jericho escribió:
John Cena tu y Chris Jericho sois los mejores me da iwal kien gane en Suvaivor Series lo uniko ke me importa es ke te recuperes pronto y vuelvas a RAW la mejor liga de todos los tiempos
Fecha: 2008-11-15 13:10:03
 

CRISTIAN ALEJANDRO LOZANO BARBOSA escribió:
john cena es lo mejor de la wwe att: el numero 1 seguidor de john cena
Fecha: 2008-11-20 15:06:20
 

yasayda ymaria escribio escribió:
jhon cene eres mi idolo somos tu fans
Fecha: 2008-11-27 17:50:52
 

MIRIAM escribió:
hola cena es el mejor luchador de la wwe es en mas guapo le mando saluos lo quiero mucho y soy su fan y vas ha ser el campeon aunque a muchas personas no les guste t kiero mucho
Fecha: 2008-11-26 15:58:17
 

Laina escribió:
viva china!!!!
Fecha: 2008-11-25 13:21:19
 

henry escribió:
lo que yo opino sober johgn cena esque es un luchadosr super xido al 100 por ciento me gusta como es y como lucha
Fecha: 2008-11-29 10:57:46
 

henry escribió:
lo que yo opino sober johgn cena esque es un luchadosr super xido al 100 por ciento me gusta como es y como lucha
Fecha: 2008-11-29 10:58:43
 

Paula escribió:
LOS FANS DE LA WWE SOBRE TODO DE RAW Y KE SEAN FANS DE JOHN CENA,RANDY ORTON,CHRIS JERICHO... QUE ME AGREGEN A paulalalista@hotmail.com
Fecha: 2008-11-29 13:43:04
 

elizabeth escribió:
john estas bien pero bien guapo y eres el mejor de la wwe soy tu fan numero 1
Fecha: 2008-12-01 18:18:46
 

gis escribió:
hola john espero que estes bien, porque eres un chavo super tierno no te conozco pero a leguas se te ve ademas estas como quieres y bien bueno adios
Fecha: 2008-12-01 18:27:58
 

Exequiel escribió:
hola soy exequiel carrizo soy fanatico de john cena
Fecha: 2008-12-03 06:35:12
 

adriana escribió:
oola cena eres el mejor de la wwe desde k kedaste lesionado y no as ido ala wwe no es la misma sin ty te amo aaa y recuerda k simpre seras el mejor te kiero musho
Fecha: 2008-12-04 11:00:37
 

luis escribió:
soy luis de paraguay y eres mi fans preferido si pudiesemos hablar algun dia este es mi mesengger
Fecha: 2008-12-07 05:23:59
 

fco tovar chuchin escribió:
john cena eres el 1er luchador que admiro y ojala que tengas de nuevo el campeonato de la wwe y quiero que me mandes un voleto para verte y quiero que me hables al 4 10 90 96
Fecha: 2008-12-07 19:20:29
 

david escribió:
hola soy un gran fanatico de john cena y espero q siga siendo un campeon mundial pesado ollo john tu no tienes correo electronico ok chao el
Fecha: 2008-12-10 17:03:48
 

yolanda escribió:
hola soy una gran fan de cena,imagino que como casi todos sus admiradores me gustaria saber si alguien sabe como hacerle llegar emails,un saludo a todos.eres el numero 1
Fecha: 2008-12-13 08:12:38
 

YAZMIN escribió:
lo unico q deseo mas en la vida s conocer a john cena y pedirl q c case conmigo aunq diga q no pero ese momento nunca lo olvidare
Fecha: 2008-12-13 22:38:09
 

yolanda escribió:
eres el mejor te admiro mucho quisiera saber tus rutinas de entrenamiento soy fanatica del deporte y conocerte en persona es mi mayor sueño anelado te queremos
Fecha: 2008-12-23 08:32:44
 

yolanda escribió:
y soy de bolivia escriveme por favor te lo pido siiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii
Fecha: 2008-12-23 08:35:22
 

raul escribió:
john eres el mejor
Fecha: 2008-12-20 21:58:31
 

Flor Fuentes escribió:
hola me llamo flor me encanta jhon cena espero que tenga una pelea con randy orton le de una paliza eres lo mejor cena, espero que me puedan dar la pagina de el y que me conteste a mi correo porfa es florjacqueline_hiphop@hotmail.com bueno espero la respuesta de jhon cena. un besito. bye
Fecha: 2008-12-22 07:24:57
 

cesar escribió:
es chido
Fecha: 2008-12-25 21:20:51
 

Paula escribió:
Vamos John!!
Fecha: 2008-12-30 13:44:24
 

megan escribió:
a mi no m importa lo q digan carlos y antonio son unos envidiosos y a vero al no gustrle tu se nota q no le gustan los hombres jajajajaja!!!!!!!!!!!!! no les agas caso para mi tu eres el mejor y mas guapo de toda la WWE sigue asi campeon!!!!!!!!!!!!!................ te amooooooooooooooo JOHN CENA WORD LIFE
Fecha: 2009-01-06 00:10:28
 

italo escribió:
jhon cena eres lo mejoe
Fecha: 2008-12-30 18:44:37
 

batista escribió:
ola amigo john cina te acuerdas abiamos tu y yo en amigos y le abiamos ganado a ls otros...
Fecha: 2008-12-31 11:07:32
 

fernando escribió:
eres el mejor luchador del mundo eres el numero 1 de mi coleccion cuan sea mas grande quiero tener los musculos como tu
Fecha: 2008-12-31 12:34:02
 

irvin david diaz arreola escribió:
ERES EL MEJOR CAMPEON ERES EL MEJOR LUCHADOR DE RAW YO QUIERO SER LUCHADOR DE LA WWE Y QUISIERA SER COMO TU TE QUIERO JOHN
Fecha: 2009-01-01 23:24:09
 

roxana simon escribió:
hola john cene me gusta como peleas me gustaria verte en persona y eres el mejor luchador de wwe soy una fanatica de ti eres un chico con mucho talento sigue adelante con tus peleas , yo soy de peru y tengo 17 años suerte.
Fecha: 2009-01-05 15:48:55
 

jessica ceseña salgado escribió:
jhohn cina tu eres el mejor te lo puedo jurar cuidate irekuerda ke te keremos muchoi cantas super te kiero mucho soy jessica de 15 años desde ke te bi por primera bes me kede sorprendida te kiero yo y los demas kuidate soy de ensenada baja california love dios rte bendiga ati y a tu familia bay mi coreo es katita_12_rbd@hotmail.com pratica con migo ok bay besoss
Fecha: 2009-01-03 01:43:48
 

ariana escribió:
hola john cina eres el mejor luchador que puede tener la wwe y para mi eres el #1 te amoooooooooooooooooooooooooooooooo =)
Fecha: 2009-01-07 17:18:13
 

fan john cena escribió:
era perfecto, pero ahora se que tiene un fallo, la fea de su novia, haha
Fecha: 2009-01-03 18:00:14
 

caren escribió:
john cena eres la persona mas linda que he visto tre años que ya no te puedo olvidar eres una persona muiy especial para mi si solo supiera tu correo realmente me conocerias y estoy segura que nos llevariamos muy bien y algo mas se que de todos los comentarios el mio nunca lo vas ha olvidar preciento algo con tigo y nunca se me va ha quitar cuidate y mi correo es caren_126... espero que me contestes porfavor chau besos .
Fecha: 2009-01-26 18:21:25
 

brenda escribió:
ERES LO MEJOR DE LAS LUCHAS CADA QUE LO VEO ES PORQUE VA HA JUGAR JOHN ERES MUY GUAPO Y MUY ATRACTIVO ME ENCATA VERTE JOHN CUIDENSE Y BESOS
Fecha: 2009-01-28 09:42:21
 

johan escribió:
jhon cena eres el mejor del mundo eres igual q yo somos siempre los primeros y visto todas tus peleas soy tu idolo...pronto nos veremos en tacna_peru
Fecha: 2009-01-27 17:25:24
 

juanalberto escribió:
que transa soy tu mejor admirador
Fecha: 2009-01-28 14:02:49
 

JESSICA escribió:
hola john cena bueno solo kiero decirte que estas bien bueno y de verdad que desde que te vime enamore de ti eres el mjor luchador de todo la historia a lo mejor muchos pensaran que exagero contigo pero la verdad es que no te amo y la verdad te deceo lo mejor de tu musica, de luchador y de actriz ojala llege alguna de la suerte y te pueda conocer ogala que vengas a mexico te amo, te amo, te amo, te amo, te amo y los que dicen que eres un perdedor es porque te tienen envidia porque tu si estas guapo y tiens exito heeeeeee estas mmmmmmmm para chuparse los dedos
Fecha: 2009-01-20 22:07:58
 

andy escribió:
john cena es gebi
Fecha: 2009-02-02 13:04:33
 

Paula-RKO escribió:
JOHN ERES EL SEGUNDO MEJOR KE LUCHAS PORKE EL NUMERO UNO SIN DUDA ALGUNA ES MI RANDY ORTON.
Fecha: 2009-01-29 13:23:29
 

Maxito escribió:
Hola John Cena Quiero Decirte Que Yo Soy Tu Fan #1 Y Te Felicito Por Que Seas El Campeon Peso Pesado Quiero Irte A Ver A Santiago De Chile Pero No Tengo El Dinero Sficiente Ni Las Entradas Mandale Un Saludo A Rey Misterio Y Dile Que Me Escriba A maxi_w@hotmail.es
Fecha: 2009-01-22 07:26:10
 

sol escribió:
teamo yon cina eres el mejor
Fecha: 2009-01-22 22:44:09
 

antonio escribió:
eres uno de los mejores luchadores de smack dow soy de peru e visto todas tus peleas y la mejor es cuando luchas con jericho chaaaaaauuuuuuuuuuuuuuuuuuuuuuuuuu..........................
Fecha: 2009-01-23 14:24:57
 

macario 291 escribió:
ami me agrada john cena pero tambien jeff hardy y rey misterio viva mexico mi correo es maca12@live.com.mx
Fecha: 2009-01-24 14:24:58
 

valeria y izayana escribió:
hola john cenna te amamos ojala que ganes en la wwe no te dejes vencer que dios te ayude cuidate
Fecha: 2009-10-05 22:52:49
 

ENRIQUE escribió:
hola john cena solo quiero que sepas que desde que mire la lucha por primera bes no la e dejado de ber y eres el numero 1
Fecha: 2009-02-05 17:07:02
 

daniel escribió:
john cena campeon del mundo eres como big show
Fecha: 2009-02-09 15:48:32
 

juan caelos cervantes escribió:
eres el mejor le pese a kien le pese yo practico el kick boxing y sabes se lo k se siente suvir a un rick ere sel mejor me gust atu estilo l aforma de ser en cuestion de ganar no cave duda ere sun ejemplo k dios te bendiga john cena suert een todo y nunk sedas siempre al frente siempre
Fecha: 2009-02-07 14:16:08
 

lesly escribió:
hola osea jhon cena es lo mejor k hay luchando y es muy lindo yo soy tu fans n 1 de toda la vida chau besos
Fecha: 2009-02-11 20:30:06
 

luis_cena escribió:
para mi john cena es el mejor de la wwe es gran luchador el rapero de todos los tiempos y por fa visiten mi web es de la wwe www.mundowwe.webs.com
Fecha: 2009-02-13 20:37:21
 

maria escribió:
John Cena eres el mejor luchador de la WWW y del mundo.
Fecha: 2009-02-13 23:00:03
 

ANONIMO escribió:
¡HOLA! JOHN CENA ERES EL MEJOR LUCHADOR DE LA WWE Y DEL MUNDO.
Fecha: 2009-02-13 23:06:23
 

karina escribió:
bueno pezzzz yo opino todo l o cotrario para mijon cina esta hecho uncuerazo es un amor ya mi me encanta su forma de ser y es un bebe lindo
Fecha: 2009-02-19 11:53:31
 

yampool escribió:
hola cena yo soy de peru yo tengo 12 años y yo te e seguido ya desde los 8 años y te seguire siguiendo por tu ers mi sueño y algun dia sueño estar alla contigo y sere igual q tu jeanpaul
Fecha: 2009-02-20 13:09:13
 

vale escribió:
0OLA!! BUENO PZZ.. SE K ESTO ES UN POCO TONTO PORK ERES UN HOMBRE MUY GUAPO PERO ME GUSTARIA KONOCERTE ESPERO K TENGAS TIEMPO MI MSN ES vale_lanenitalinda@hotmail.com BUENO CUIDTE TE MENDO UN BSO BYE
Fecha: 2009-02-20 23:48:01
 

carlos ruiz escribió:
ey cena sos el mejor soy fanatico de la wwe mi peleador favorito es jonh cena y rey misterio echale ganas para ser el mejor
Fecha: 2009-02-23 14:15:47
 

LOLA escribió:
ESTAS BIEN SABROSO ERES EL #1 TE AMO TU MAMA DEBE SER REPOSTERAN MIRA EL BISCOCHO QUE HIZO
Fecha: 2009-02-23 10:37:12
 

elenitha escribió:
ey cena eres lo mejor de lo mejor no te dejes rendir tu seguiras siendo el campeon de la wwe y preparete para ganarle a edch
Fecha: 2009-02-18 19:14:27
 

maria fernanda farfan scarpett escribió:
FERNANDA Hola john solo kiero desirte q' eres mi luchador super faborito .esto te va a sonar m uy chistoso,cada q' te pegan les digo muchas cosas malas bay. t.k.m.
Fecha: 2009-02-28 14:31:41
 

graciela jean pierre escribió:
john cena es el amor de mi vida es la fuerza que me mueve y me da vtda y me hace muy feliz te amo john cena
Fecha: 2009-02-28 16:16:29
 

josè alberto escribió:
ps yo kiero ke yohn cena ke tenga el cxampionato pesado y ke le gane a eggs hehehe ps para mi es buena onda yohn cena y tambien es bien chido para los golpes y ps yo le voi a yohn cena tea hehe ps a ki me des pido bye
Fecha: 2009-02-28 17:39:56
 

luis y omar escribió:
eeres una persona de admirar me tienes sorprendido como peleas ly no agas caso de esos envidiosos que dicen que te metes algo si sse ponene a investigar los anabolicos te dan aire y no fueza y ati eso es lo que te sobra suerte cina eres el mejor.
Fecha: 2009-03-02 12:08:02
 

omarr escribió:
eres una persona que me llama muchoa la atencion, tus pechos son grandes como de lorena errera nomas que aty te ace falta cadera john cina a love forever.
Fecha: 2009-03-02 12:10:18
 

genesis bello escribió:
john cena eres mi idolo,soy tu fan n..1.y eres el mejor de la wwe como tu nadie ok nadie te felicito x tus mas grandes exitos sigue asi y no te lleves de esos malos comentarios.que esas jentes estan envidioso sigue asi y no le pare a na cuidate muchos besos muaaaaaaaaaaa espero tu respuesta te aaaaaaaammmmmo cena muaaaaaaaaaaa adios.
Fecha: 2009-03-06 12:30:08
 

Roxxana Berenice Star escribió:
Que chistosa me voy a escuchar pero me he enamorado ya que tienes muchas cualidades y eres hermoso de todos lados, quisiera tenerte unas horas a mi lado, te admiro y te amo de verdad.
Fecha: 2009-03-04 15:10:02
 

andrea alcocer escribió:
john cena agregame si eres el mas guapo eres un cuerazo eres el mejor de los luchadores te voy ir a ver en la wwe y ke me regalaras una gorra o una de tus playeras i love you
Fecha: 2009-03-10 18:34:07
 

KAREN escribió:
HOLA JON CENA TE AMOOOOOOOOOOOOOOO PASAME TU AMIL ERES LO MEJOR CHIQUITO ERES TAN GUAPO TAN FUERTE QUE TODAS LAS CHAVAS SE MUEREN POR TI ESPERO TU MENSAJE TE Q.M.T.M QUISIERA CONOCERTE EN PERSONA TE MANDO ESTE MENSAJE SOY DE JUAREZ TE QUIERO BUENO BIE
Fecha: 2009-03-09 17:56:08
 

adriana escribió:
JOHN CENA I WILL LOVE YOU FOREVER BECAUSE YOURE MY LIFE JOHN CENA TE AMO ALGUN DIA TE CONOSERE SOY TU FANS NUMERO ONE TE AMO
Fecha: 2009-03-10 17:01:41
 

adriana escribió:
JOHN CENA I WILL LOVE YOU FOREVER BECAUSE YOURE MY LIFE JOHN CENA TE AMO ALGUN DIA TE CONOSERE SOY TU FANS NUMERO ONE TE AMO
Fecha: 2009-03-10 17:03:55
 

GUILLERMO M. escribió:
JOHN, ERES EL MEJOR! DIGAN LO QUE DIGAN, SON TONTOS, TU ERES EL MEJOR DE LA WWE. ADIOS! SOY FANS TUYO!
Fecha: 2009-03-18 10:35:26
 

pablo gonzalez escribió:
john cena soy tu fan numero 1 ojala un dia pueda conocerte tu deverias ser el campion de los pesados no el estupido de edgge lo gano por trampa que vueno que isiste llorar ala señorita esqiusmi osea viki guerrero
Fecha: 2009-03-07 22:21:27
 

norma gonzalez escribió:
john cena es el mas guapo de todos los luchadores
Fecha: 2009-03-07 22:35:15
 

cinthia rodriguez escribió:
hola john cena quiero decirte que eres el mejor de todo y bueno no te voy a decir que soy tu fans # 1 pero no me importa cer la #2 o 3 lo que pasa es que soy tu fans una que te quiere mucho y desea conocerte en persona pero bueno yo creo que eso nunca va a suceder pero dicen q la esperaza es la ultima que se pierde asi ps no las voy a perder espero que leas esto eres un ejemplo para mi nunca te rindes y yo tampoco lo hare no desecciones a tus fans yo te admiro y te quiero mucho y sueño mucho contigo ps mucho dicen q estoy loca pero no importa te quiero john cuidate que DIOS te BENDIGA y franco no te preocupes john va ganar el titulo world wrestinng champion bye adios se despide cinthia_one@hotmail.com de Honduras besos
Fecha: 2009-03-11 15:13:38
 

jose clemente escribió:
eres el mas bueno de pelear sale
Fecha: 2009-03-12 10:10:13
 

IVONNE escribió:
HOLA**++ PS !!JOHN CENA!! ES EL MEJOR ADEMAS ESTA SUPER GUAPO ES LO MAXIMO LO AMOOO
Fecha: 2009-03-12 14:02:22
 

MARIANA escribió:
HOLA MI HERMANA TIENE 4 AÑOS Y DICE QUE ESTAS BIEN BUENOTE CON TUS MUSCULOS BUENO ADIOS
Fecha: 2009-03-12 19:31:19
 

kely escribió:
soy tu tu almiradora q te de sea muchas felisodades entu darrera
Fecha: 2009-03-13 15:35:58
 

JULIA ARREDONDO escribió:
hola jonh cena quiero que sepas que eres mi amor platonico y que lunes y viernes espero con unas ancias verte en la WW LUCHANDO mas que nada porq eres un luchador super especial ya que eres muy guapo y tengo tu pelicula y unos de tus fotos eres el mejor luchador le pese a quien le pese no lo olvides mi amor platonico JONH CENA kissssss
Fecha: 2009-03-16 19:23:04
 

evelin escribió:
HOLA JOHN CENA QUIERO DECIERTE QUE ERES EL MEJOR DE TODA LA WWE SOY TU FAN NUMERO 1 BUENO BYE ERES EL MEJOR SE DESPIDE EVELINALONSO2000@HOTMAIL
Fecha: 2009-03-13 22:19:08
 

Leslie escribió:
pss io pienso k john cena, jeff hardy triple h zo0n lo0z MEJORES!! i buenooo voii a verlz a monterrey eaea byee
Fecha: 2009-03-17 20:34:36
 

francisco escribió:
jonh es pero q leas esto y te comuniqez tengo todo de ti playeras gorras cadenas tengo toditito de ti
Fecha: 2009-03-17 20:57:33
 

EDGAR escribió:
jonh cena eres el mejor no tedejes de los de mas tu superate en la lucha y gana bueno yo tambien quiero ser luchador bueno pasame tu correo electronico
Fecha: 2009-03-18 01:01:20
 

linitha escribió:
hola guapote soy una almiradora tuya te amo eres lo maximo de la wwe espero que me escribas porque yo te adoro
Fecha: 2009-03-21 22:51:16
 

jovel hernandez guadalupe lizbeth escribió:
yon cena te kiero mucho te admiro y te respeto ayuda a triple h a acabar con randi orton pero primero gana tu cinturon,vengan a tuxtla gutierrez no se arrepentiran eres el mas guapo de los luchadores todas morimos por ti eres lo maximo ,vive la vida al maximo
Fecha: 2009-03-26 19:11:31
 

jovel hernandez guadalupe lizbeth escribió:
yon cena te kiero mucho te admiro y te respeto ayuda a triple h a acabar con randi orton pero primero gana tu cinturon,vengan a tuxtla gutierrez no se arrepentiran eres el mas guapo de los luchadores todas morimos por ti eres lo maximo ,vive la vida al maximo
Fecha: 2009-03-26 19:14:36
 

lore escribió:
john cena es verdaderamente un papito y se desenvuelbe en el ring como un dios es el mejor de hoy y de siempre le guste a quien le guste y a quien no se la cala xq john cena es y segira siendo el mejor OK..!!!
Fecha: 2009-03-27 17:56:39
 

itzel celeste escribió:
john cena eres el mejor me gustaria conocerte o hablar con tigo plis dame tu correo electronico soy de culiacan,sinaloa
Fecha: 2009-03-22 17:53:32
 

karen escribió:
john es el mejor luchador de la wwe,esta super guapo es el luchador que me hace suspirar y me hace escribir canciones y poemas estas palabras son algunas de lo que pienso en ti. hoy en mi abitacion ,no ai nada ami alrededor solo tu..... la persona que me hace suspirar. pienso en ti cada momento, cada segundo en cada lugar en donde estoy doy un suspiro solo por tu amor. y pienso que la vida no tiene razon sin tu alegria que me trasmitas al ver que todas las noches sueño contigo pienso que eres una razon por laque las personas sonrien cada dia. atte:karen de monterrey
Fecha: 2009-03-23 21:21:35
 

karen wer escribió:
eres para mi el numero uno eres el mejor kiero q seas el campeon forever y te kiero mucho john cena
Fecha: 2009-03-25 17:53:04
 

tamara escribió:
john cena es un papito y save luchar y soy fanatica ojala que no se retire nunca
Fecha: 2009-03-25 19:41:00
 

teresa solis escobedo escribió:
buno pues yo soy super fanatica tuya megusta como luchas eres el mejor y leei los comentarios de los demas y la mera verdad n meguata como ay chavos k se espresan haci de ti el chavo o chava k n te apoya es un ipocrita y tambien n deberia de estar mandando mens para estarse burlando d ti estas bien guapo y me gustas mucho bueno pues cuidate mucho bay
Fecha: 2009-04-04 16:44:10
 

farid escribió:
cena eres el mejor dela wwe y el mas fuerte por aver cargado al mounstrote de big show los otros mienten yo soy tu fan 1 saludame a rey
Fecha: 2009-04-04 16:52:50
 

Yeisely escribió:
Cena te amo eres el mejor te escribo desde El Salvador creeme que cuando te vi por primera vez que veniste a El Salvador me emocione eres muy lindo.......
Fecha: 2009-04-05 15:05:08
 

karen rosas escribió:
hola seria super k leyeras mi mensaje pork la neta ers super soy una super fanatika d ti eres el mejor y estas super lindo tengo miles de fotos tuyas y nome canso de mirarlas eres super lindo espero y algun dia me escribas y espero un dia ir a vert enla wwe en E.U ok bueno espero y lo leas soy karen sanchez rosas bye cuidat eres genial I LOVE FOR EVER. eres el mejor de todos nunk kamvies yo tu mayor admiradora y no me duermo hasta mirar toda la lucha el lunes y el viernes ok bye. mi correo es karenprincess94@hotmail.com.
Fecha: 2009-04-09 10:28:20
 

ESTHER escribió:
HI JOHN CENA TODAY I SAW YOU IN WRESTLEMANIA YOU WERE AWESOME !!!!!AND I TELL YOU WHAT YOUR THE LEGEND!
Fecha: 2009-04-05 22:15:54
 

fany escribió:
JOHN CENA solo te digo que eres el mejor del mundo y que solo dicen que eres un drogadicto porque te tienen embidia ¡¡¡¡¡¡¡¡¡¡Eres SUPER!!!!!!!!!!
Fecha: 2009-04-06 16:59:18
 

isabel escribió:
ojala que estes leyendo mi mensaje y si es asi pues ya gana aprende al batista bu pero aun asi estas bien guapo
Fecha: 2009-04-06 19:55:21
 

nadia paola aguilar castañeda escribió:
hola john cena ya me presente contigo feliz cumple años el dia 23 de abril y que sigas cumpliendo muchos mas es tu mejor deceo de una gran amiga tu ya aun que no me conoscas yo ter considero un gran amigo tuyo
Fecha: 2009-04-20 10:58:17
 

get escribió:
gggguuuuuaaaaaauuuuuu john cena es la super star de wwe aunqe eso no se los nesesito decir vdd iiii x supuesto el + pro + guapo esta q ni pra q hablar i eres superrrrr soi tu fannn numero 1 i pra demostrartelo tengo tdo9 mi cuarto ieno de tus ftos etc i mis cuadernos i miiii casillero bno eres el mejor i nadie pro nadie te iguala i fue genial cmo cargaste a edge i a big show iii te qedaste cn el cituro es eso fue genial x q tu te lo mereses i algun dia me gustaria cnserte iiii seria genial berte asi enfrente de mi iii poder platicar cntigooo ovvvio es lo q tdos i tdas tus admiradoras qieren vdd bno aunqe io ia te vi pelear en wrestlwmania25 estubiste genial pro mi sueño dorado es q te pueda cnser iii q nooo la psemos sper bno ba bai te cuidas x q nooo qiro q te pse nada okisss ba bai 0_o
Fecha: 2009-04-13 14:43:38
 

nasdia paola aguilar castañeda escribió:
porque no salen las letras
Fecha: 2009-04-20 11:03:22
 

ANA escribió:
TU ERES MUY BUENO LUCHANDO ERES MI LUCHADOR FA BORITO AL GUN DIO QUISIERA CONO SER TE CON CARIÑO ANA
Fecha: 2009-04-13 19:13:48
 

angel jimel castro baltazar escribió:
hola soy angel solo quiero de sirte que soy tu mas grade admirador eres el mejor de todos, como disen que me paresco a ti me pusieron john cena pero mas me disen cina, mi email es angelcina@hotmail.con
Fecha: 2009-04-09 13:01:06
 

LUNA escribió:
eres el mejor jhon cina mi correo es coryi_87@hotmail.com
Fecha: 2009-04-10 10:58:16
 

nadia paola escribió:
hola jonh cena...deja que me presente soy nadia paola tengo muchas ganas de tener un amigo luchador megustaria platicar tengo tres hijas ytienen ganas de conocerte nosotros vivimos en tijuana si algundia tienes tiempo para conversar con mucho gusto bye asta pronto----
Fecha: 2009-04-11 11:20:19
 

alejandra escribió:
HOLA SOY ALEJANDRA DE LEON GUANAJUATO JOHN CENA ERES EL MEJOR DEL MUNDO PORFAVOR VEN A LEON YO TE INVITO A MI CASA CUANDO QUIERAS AL FIN Y AL CABO ES TU CASA PERO PORFAVOR VEN TENGO MUCHAS GANAS DE CONOCERTE Y A PARTE YO SOY TU FAN NUMERO 1 TE QUIERO JOHN CENA PORFAVOR ACEPTA MI INVITACION O.K BYE SALUDOS A TODA TU FAMILIA O.K A HORA SI BYE
Fecha: 2009-04-14 15:01:17
 

ANGEL escribió:
OLA JOHN CENA ERES EL MEJOR LUCHADOR DE TODOS ME ATMIRAS MUXXO COMO LUCHAS CON LOS DEMAS LUCHADORES ERES EL MEJOR LUCHADOR PARA MI I LOVE JOHN CENA
Fecha: 2009-04-14 17:16:26
 

sofia escribió:
sabes yo se que no contestaras estos mensajes de todos tus fans x q son de masiados pero queria decirte auque no lo contes que me encantas bueno de todos modos si lo contestas que lko dudo que me mandes tu correo plis y love
Fecha: 2009-04-11 14:08:25
 

anai escribió:
ola yon cina tueres el mas guapo y tueres el meromero de la wwe tedeseo toda la suerte de todo elmundo i yo soy tu fans numero1 gana tedigo adios
Fecha: 2009-04-20 16:39:11
 

manuel escribió:
el 17 de abril ganaste contra johon maicod y mandame tucorreo
Fecha: 2009-04-11 22:02:18
 

luis francisco henriquez buera escribió:
soy fanatico de john cena espero que siga siendo campeon mundial pesado y que blackash 2009 le gane a edge y siga siendo campeon mundial pesado y quiero que algien me de el correo electronico de john cena JOHN CENA ES EL MEJOR DE TODA LA WWE
Fecha: 2009-04-15 12:35:51
 

marisoOLitha escribió:
te amo con todo el corazoON eres lo mejor de las luchas wwe jajaja eres super lindo cuidate moxOo te amo con todo el corazZoooOON eres la mejor persona del mundo bye nunca olvides i love you forever
Fecha: 2009-04-12 16:34:28
 

matias maciel escribió:
hola, te agradeceria mucho si me mandarias tu correo electronico, gracias
Fecha: 2009-04-12 17:38:57
 

cena el mejor escribió:
cena eres el mejor de la wwe no le hagas caso a esos bobos ................. que tienen pura envidia de ti soy tu fan hasta todo el mundo a mi me dice cena fan numero 1
Fecha: 2009-04-12 20:03:16
 

olga escribió:
hello john cena eres el mejor de todos nadie te iguala a ti por que eres le mejor siempre seras el fans numero 1 100% john cena te quiero cena aaaaaaaaaaa y cantas muy bonito jejejej
Fecha: 2009-04-13 12:18:14
 

belen escribió:
john cena eres lo mejor 1000000000000000% eres lo mejor de la wwe no me pierdo tus luchas te quiero muchisimo bye tu fanatica belen
Fecha: 2009-04-15 18:15:37
 

karla escribió:
hola john cena eres lo maxim0 te quiero mucho eres el mejor luchador tu amiga karla
Fecha: 2009-04-15 18:22:03
 

c0ral escribió:
ola soy fanatica de john cena es el mejor lo adoro
Fecha: 2009-04-20 19:25:48
 

fani escribió:
ola me iamo fani john cena eres el mejor de la wwe me guztaria konozerte i tener thu korreo para platikar te kiero muxo me enkntaz eres lo maximo te kiero biiee lovee todoz te tienen envidia de thu cuerpazo john cena te amo pliz me mandaz thu korreo
Fecha: 2009-04-17 14:38:02
 

jesS escribió:
oLa oLa ii yo mE pregunto !!!* como no ba a ser el mejor del mundo si con solo mirarlo todas nos emosionamos esta carita (guapisimo) es simplemente el amor de nuestras vidas de todas... pero simplemente yo lo amo demasiado que abeses me ago daño por el ... jha esa rola es una que inbente ja tengo bandita de rock-punk y amo el rap y el hip-hop amo su rola de john cena la de my time is now esta de poca lo juro bueno bye bye john cena You are the love of my life my email is pxnditx_xzul_mxrino_3mo@hotmail.com
Fecha: 2009-04-21 12:12:32
 

MarLen rdz escribió:
i love john cenaa jajajaa ess lo mejorr amm i ke kon los komentarios de los weiiess qe qiere kopiar a the rock jajaja esookkee ni al kaso john cena es uniko thee amoooo john cenaa
Fecha: 2009-04-18 01:44:55
 

rodri escribió:
john cena sos el mejor luchador de mundo te animas una pelea con el undertaker
Fecha: 2009-04-21 13:13:57
 

tania abigail diaz lopez escribió:
la verdad jon cena te quiero pedir unos boletos para tu evento en el palacio de los dportes por que soy tu fans n=1 y si l verdadestas echo un papacito t amo besitos
Fecha: 2009-04-18 20:13:04
 

andres escribió:
k onda john cena eres el mejor luchador de la wwwe pero heeg te gano el conpionato lo tienes que quitarselo tu trofeo a adios cena soy de nayarit cuidate cena y ganas las luchas yo te apoyo y me gusta la que dices no me ves
Fecha: 2009-04-21 15:38:50
 

JON@TAN escribió:
HOLA YO SOY JONATAN JOHN CENA ERES EL MEJOR DE LO LUCHADORES
Fecha: 2009-04-21 15:41:15
 

jaime "pipicena" escribió:
cena ere eel mejor ya sabes tu ganas al ke se te ònga enfrente tu sabes eres el mejor e toda la empresa de la wwe ya te apoyo bye kiZ
Fecha: 2009-04-19 11:12:48
 

VIRIDIANA escribió:
JOHN ERES SUPER GUAPO ESPERO CONOCERTE EN PERSONA YO SOY MEXICANA, ERS EL NUM 1 NO TE OLVIDES DE TUS FANS DE AQUI DE MEXICO T.Q.1.CH... BUENO ESPERO Q T RECUPERS DE LO Q T HIZO BIG BOBO
Fecha: 2009-05-02 00:31:35
 

LUIS escribió:
JOHN CENA sabes qe eres el mejor en la wwe yo te apoyo soy tu fan.
Fecha: 2009-04-29 10:23:29
 

MIGUEL escribió:
yo tambien soy fanatico de jonh cena espero que le den un lugar en el salon de la fama y tengo todo lo de john cena adios y espero conocerlo algun dia
Fecha: 2009-04-22 14:50:48
 

GABI escribió:
somos de silla i los llamamos gabi arron fran i alberto i nos gusta mucho el prerssing chatx i jhon cena es nuestro luchador preferido i nuestro mejor escenario es wrestermenia 25 i mahmahon es un abuelo cascarabias i viejo i viva el pressin chatx
Fecha: 2009-05-01 11:48:40
 

CINTIA escribió:
IO AMO A JOHN CENA I KISIERA SABER SU CORREO EL ES EL MEJOR LUCHADOR DE LA WWE Y EL MUNDO SOY SU FAN #1 TENGO TODAS SUS COSAS Y ME ENCANTARIA CONOCERLO ALGUN DIA Y SI PUDIERA IR AL PALACIO DE LOS DEPORTES SERIA GENIAL PERO NO HAY DINERO
Fecha: 2009-04-25 21:37:06
 

¡¡alejandra!! escribió:
john cena eres el mas wuapo sxy yo soi tu fan num. 1 tengo todo el 30 de mayo voi a ir al palacio de los deportes a verte ay eres wow feliz cumpleaños 32 este 23 de abril te prometo qe ire hasta adelante te amo mas qe a nadie nadie te ama como yo lo prometo
Fecha: 2009-04-26 13:05:05
 

lupita escribió:
john cena eres el mejor eres un papucho te amo quiero tu correo
Fecha: 2009-05-01 19:47:54
 

jon cena escribió:
hola
Fecha: 2009-04-27 12:38:55
 

hilda escribió:
hola john:solo quiero decirte que me encantas,y no nadamas a mi,por supuesto que que a mis hermanas tambien y muchas fans mas,estas guapisimo y me encanta tu cuerpo,para mi eres el mejor luchador,pues no se si nos respondas los mensajes pero me gustaria que me escribieras,se que vienes a queretaro,me encantaria conocerte chao,besos
Fecha: 2009-04-27 13:51:31
 

hilda escribió:
ah..oye feliz cumpleaños el pasado 23 de abril,te deseo lo mejor y que sigas cumpliendo muchos mas,guapo con esos ojos tan hermosos que tienes
Fecha: 2009-04-27 14:08:31
 

dulce maria escribió:
hola sabes el mejor luchador de la wwe eres muy guapo y me gustaria cononcerte en persona pienso que seria padre bueno cuidate te dejo un gran saludo.... siempre sigue asiiiii..... dulce maria
Fecha: 2009-04-27 15:39:38
 

mariela lovess john cena !! escribió:
john cena eres el mejor soy tu mas grande fan eress guapizzimo tienes ina sonrriza hormozza!!! porcierto que bueno que perdio big show cuando te apareciste jajaja ♥pero se lo tenia merecido porque tambien por su culpa tu perdiste el domingo, porcierto... odio a big show y a ese mugre viejo ke te reto quen se cre? aber que a el lo abienten contra uhn foco y al otro dia que lo reten aber si puede bueno ia fue mucho ... eres el mejor el #1 aaa pocierto ia mero cumplo años y lo que quiero que me regalen es una camiseta y una gorra como la tuya bueno byee ☺☺ (john cena el mejor)
Fecha: 2009-04-28 11:46:45
 

cena fan escribió:
john cena es el mejor lo apoyo contra big show y edge the miz es un tonto no la hace contra cena ni jerico bay saludos a cena
Fecha: 2009-04-28 12:50:43
 

monse escribió:
john cena!!!!!!! es super guapo soy tu fan#1 me encantas y me gustaria conocerte en persona TE AMO
Fecha: 2009-05-03 16:16:03
 

marzela escribió:
jhon cena es mi novio jajajaja
Fecha: 2009-05-07 14:07:50
 

jazmin berenice vite guardiola escribió:
soy bere y quicisiera decirte que eres el mejor luchador del mundo y te juro que cam biaria lo que sea por ti y quiero que se pas que parami eres el mejor luchador bay bay y que me gustaria verte en persona y cuando salgas en la tele quiero que memandes saludos y que le digas ala gente que yo digo que eres el mejor luchador bay a A.T.T.E. berenice vite guardila DE:nava,coahuila PIEDRAS NEGRAS echale ganas P.T.Aqui todos lo de familia te admiramos y mi mama junto con migo decimos que estas bien bueno jaja A.T.T.E. LA NIGROPETENCE BERE
Fecha: 2009-05-03 21:02:36
 

pablo garcia perez escribió:
me gustaria conocer a John Cena en persona vivo en Lazaro Cardenas Mich aka en Mexico por favor enviáme tu camisa y tu córreo électronico porfa me gusta como peleas te en céyare español me mandas un autografo de Jeff,Rey Mysterio,Batista pliz te lo pido
Fecha: 2009-05-04 21:52:18
 

MITZY YARELY escribió:
PUES YO OPINO Q JOHN CENA ESTA BIEN BUENOTOTOTE Y AMI NOM IMPORTA SI GANA O PIERD YO SEGIRE SIENDO SU FAN OJALA Y CUANDO SE RECUPERE LE PONGA UNA PUTISA A BIG SOW Y OTRA A EDG.
Fecha: 2009-05-05 03:59:55
 

ALEJANDRA SANCHEZ escribió:
YO SOLO KIERO DESIRLE A JOHN CENA KE GANE O PIERDA LO BOY A SEGIR APOYANDO Y OTRA KOSITA TE AMOOOOOOOOOOOOOOOOOOO KON TODA MI ALMA Y ESTAS BIEN PAPASOTEEEEEEEEE ADIOS Y REKUERDA KE TE AMOOOOOOO.
Fecha: 2009-05-05 04:05:08
 

yael escribió:
eres el mejor jonh nadie te va a ganar
Fecha: 2009-05-09 12:36:43
 

melissaaa escribió:
OLAAAA JOOHN CENAA ERES UN SUPER LUCHADOOR SOMOS DE TABASCOO Y TODOOS POR AKAAA TE QIEREMOS MUCHOOO NUNCA NOS PERDEMOOOS TUS PELEEAAAS INCHEEES GALLINONAAAAS! DEEE EGCHE Y LA BALLENONA ESA DE BIG SHOOW ARIIBA LA JUSTICIIIA EL RESPETO Y LA LEALTAD RECUPERATE PRONTOO ^^ BAAAAAA&
Fecha: 2009-05-05 12:31:34
 

carlos escribió:
john cena eres mi hidolo eres el mejor tu musica es la mejor de wwe te kiero conocer ese es mi sueño dorado soy de mexico d,f
Fecha: 2009-05-05 12:40:50
 

jerhanyaa escribió:
ola jon tengo 9 años y me sacrifico por berte y nunca me duermo y ese big shou es una puerca masa de pelos mi madre me ba a comprar una piñata de el y le boi apegar. recuperate yo hare lo posible para ir ala lucha y tengo tu sonidito grabado y cuando bienes a mexico ilove'u a i mira justicia leaitad respeto ii verdad recuperate pronto mi campion de la wwe ´¨) bae dios llebe angeles con tigo y big shou no te ba a benser
Fecha: 2009-05-05 12:44:35
 

Jose German Rivera Vasquez escribió:
quisiera conocer a john cena es el mejor luchador de la wwe es lo mejor de hoy por hoy, bueno espero que leas esto. saludos.
Fecha: 2009-05-06 16:30:36
 

leticia escribió:
hola eres un super luchador y eres muy carismatico y bueno sigue asi
Fecha: 2009-05-05 13:45:22
 

gisell rebeca escribió:
john cena, cody roses y jeff hardy ahh!! esos si son hombres!!! umm ke daria por tener un hombre asi!! =D jeje saludos
Fecha: 2009-05-05 16:57:34
 

sarahi escribió:
john eres lo mejor y maximo digan lo que digan siempre seras el mejor t.k.m bye te adoro
Fecha: 2009-05-06 18:35:42
 

yesenia escribió:
hola cena es mi fan quisiera conocerlo quiero saver si el me puede agregar te dejomi msn para q aver si se me cumple el milagro y me agrgas va te adoro cena : rock-23893@hotmail.com
Fecha: 2009-05-06 22:48:24
 

antonio escribió:
espero te rrecuperes pronto para q le des su palisa al mastodonte tu eres el mejor JHON CENA
Fecha: 2009-05-05 20:25:32
 

yesenia escribió:
john te adoro quisiera poder hablar con tigo te dejo mi msn es rock-23893@hotmail.com espero y te pongas en contacto con migo bye
Fecha: 2009-05-06 22:50:43
 

DIEGO escribió:
ERES EL LUCHA DOR MAS FUERTE Y MEAGRADAS
Fecha: 2009-05-06 14:59:55
 

manuel escribió:
john cena eres el maximo de la lucha libre de la wwe i de grande quisiera ponerme como tu y sabes ya me estoy póniendo
Fecha: 2009-05-10 00:30:26
 

LiIsSs escribió:
john eres lo maximo m enknta tu actitud y espero conocerte en persona algun dia. te deji my msn para q m agregues y plis mandam auqcea un saludo si no queres perder tu tiempo ok lis_pushu@hotmail.com echale ganas el big show no es + q un cobarde. Espero q te recuperes pronto.
Fecha: 2009-05-08 13:22:50
 

erika escribió:
hello oie eres lo mejor te a mooooooooooooooooooo
Fecha: 2009-05-08 19:47:10
 

rosal escribió:
eres lo mejor pero menos q jeff hardy
Fecha: 2009-05-12 19:05:25
 

denise escribió:
jonh eres super que te compongas pronto y te adoro te amo
Fecha: 2009-05-08 23:12:13
 

mario escribió:
oye que ondas se paso bit chou por lo que te iso en la pelea espero que le ganes vengate de lo que te iso ok bay chau
Fecha: 2009-05-09 00:02:17
 

Daniel escribió:
Que ondas John cena se pasa bichou quiero que le peges una vergisa...ok
Fecha: 2009-05-09 00:12:48
 

laura escribió:
ola john cena aky dejando un mensaje y decirte que soy tu fan me encanta como peleas y nunca me pierdo una pelea tuya te dejo mi msn para que me agreges ok te cuidas G-N_17-10@hotmail.com
Fecha: 2009-05-10 18:53:44
 

mari cruz escribió:
jonh cena te amo pero quiero que te venges de big chou no me agrado lo que te hizo espero y algun dia me contestes mi correo es jeymari._@hotmail.com espero tu respuesta eres el mejor de todo el mundo soy tu fan nùmero uno si lo lees contestame te quiere mari cruz
Fecha: 2009-05-11 18:25:08
 

adriana escribió:
john cena te adoro ers lo maximo eres la persona mas linda k ee konosido en toda mi vida eii mi amorssote algun dia te voy a conoser te amo y kuidate aaaa cena vengate de themis y de la ballena big show agregame pliss oyes me enojo kuando disen k ellas son tus fans nimero uno pork yo soy I WILL LOVE YOU FOREVER BECAUSE YOURE MY LIFE...
Fecha: 2009-05-12 19:44:28
 

adriana escribió:
john cena te adoro ers lo maximo eres la persona mas linda k ee konosido en toda mi vida eii mi amorssote algun dia te voy a conoser te amo y kuidate aaaa cena vengate de themis y de la ballena big show agregame pliss oyes me enojo kuando disen k ellas son tus fans nimero uno pork yo soy I WILL LOVE YOU FOREVER BECAUSE YOURE MY LIFE...
Fecha: 2009-05-12 19:48:48
 

juan alberto escribió:
eres chido john cena tequiero conocer y me visto como tu y te vere el lunes en la tele peles cido y haces el no mebes
Fecha: 2009-05-22 12:08:11
 

BRISEIDA WAPA escribió:
EREZ EL MEJOR LUCHADOR DL MUNDO... CLARO I EL MAZ WAPO I ATRCTIVO.. BEZOZ... T KIERO MUXXXXXXOOOOOOOOOOOOOOO......
Fecha: 2009-05-19 18:09:36
 

eli escribió:
eres mi fan numero 1 tengo el poster tuyo i eres mui guapo y te felizito por q ayer le ganastes a randi orton y a sus amigos i peleas muy bien
Fecha: 2009-05-19 16:52:00
 

gonzalo escribió:
soy tu fan numero 1 kiero conocerte en persona plis bye
Fecha: 2009-05-13 18:52:35
 

maria escribió:
john cena es el mejor a y es mio no se los comparto ok. soy de mexico
Fecha: 2009-05-13 19:30:31
 

maria escribió:
john cena es el mejor a y es mio no se los comparto ok. soy de mexico
Fecha: 2009-05-13 19:31:02
 

karla escribió:
joncina estas como quieres soy tu fqans numero (1)te amo papasito
Fecha: 2009-05-22 13:19:09
 

marco tulio jimenez martinez escribió:
john cena eres el mejor sabes unos dicen que es mejor batista pero yo digo que estan locos nadie es mejor que tu me gustaria que dieras un mensaje para el hermoso pueblo de madrid atte:tu admirador y fans n0.1 marco tulio
Fecha: 2009-05-14 10:04:21
 

mireya isabel escribió:
ho0la!! bueno0 esztasz bien guapo0 la verdad y o0jala para el o0tro0 año0 bengasz a jaliiszco bueno0 bye
Fecha: 2009-05-16 14:10:17
 

Stp t...!!! escribió:
Hola John antes q´nada t doy mis mejores felicitaciones pues dejame decirt q´me facina ver todas tus peleas eres el mejor,,, y tus canciones son geniales deveras t la rifas jajaja...!! Me gustaria q hicieras más peliculas pues si así en sta tuviste mucho exito pues yo creo q´las pxoximas q´ hagas tendras mucho más para q se les quite a los otros luchadores por q´suenan muy ardidos jajaja Saludos t mando mushoooss Besoooosss!!! Guapo Muak...
Fecha: 2009-05-14 13:58:19
 

ERIKA escribió:
HELLO!!! JOHN CINA STAS HECHO UN BOMBON,SRS LO MAXIMO, LO MEJRO DE LA WWE,T´ AMOOOOOO .......
Fecha: 2009-05-16 14:41:28
 

ricardo escribió:
hola john cena cuando vienes a tlaltenango zacatecas mexico
Fecha: 2009-05-15 11:42:59
 

karina escribió:
john estas echo un bonbo eres un papi pueste acmiro mucho por tu carrera y esn la wwe y la otra pero adios te amo
Fecha: 2009-05-15 18:02:34
 

jesus escribió:
hola soy de mexico quiero que mandes saludos a mi compañera por la t.v por k se duerme hasta k peleas
Fecha: 2009-05-21 17:01:59
 

IVAN escribió:
john eres el mejor y ojala q seas campeon muy pronto y le quites el titulo a eddg
Fecha: 2009-05-22 19:44:26
 

diana escribió:
john cena estas ipermega guapiiissssisssisssimo te amo eres el mejor de la wwe
Fecha: 2009-05-22 20:42:00
 

leonardo escribió:
eres lo mejor cina sigue asi y le ganaras a randi orton
Fecha: 2009-05-22 21:01:51
 

érika escribió:
john cena es el mejor luchador de el mundo y los que hablan mal de el estan selosos porque nunca van a ser igual que el jajajaja john cena eres el mejor...
Fecha: 2009-05-21 18:00:33
 

AIDE TE KIERO CENA escribió:
JOHN CENA ERES EL MEJOR DE TODO EL MUNDO LO UNICA K ESPERO ES YEGAR A VERTE EN PERSONA TE AMO ERES EL MEJOR TE ESPERO EN LA ARENA MONTERREY
Fecha: 2009-05-21 18:17:18
 

CECILIA escribió:
HOLA JONH CENA MI MAS GRANDE SUEÑA ES PODER CONOCERTE PURO NO PUEDO POR QUE NO TENGO DINERO SON TU FAN N°1 QUE ESTES BIEN CON CARIÑO CECI ENCERIO UN DIA PODRE CONOCERTE NO PIERDO LA ESPERANSA VIVO EN CELAYA ADIOS¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡
Fecha: 2009-05-21 18:34:47
 

leo cena escribió:
hola cena por fa pasame tu correo el mio es leo_fut_2009@hotmail.comy me puedes a enseñar a ser la no me puedes ver jiji
Fecha: 2009-05-21 19:25:25
 

alejandra escribió:
Hola chicuelos yo soy alejandra pero me dicen Big Lex y la neta le cale a quien cale Jonn Cena es el mas fregon de WWE y no solo porque tenga unos ojos increibles, si no porque tiene una exelente calidad de lucha para estar en RAW.Cena te espero este 30 de mayo en el palacio de los deportes erer el numero1.Chavos si pueden pasenme su correo no sean gachos, el mio es big.lex@hotmail.com Oya de plano libraverde@hotmail.com
Fecha: 2009-05-21 20:54:25
 

ROXANA BERENICE STAR RODRIGUEZ escribió:
Hola papasito te espero este 27 de Mayo en la arena monterrey. Tu fan No. 1, te adoro Roxanna Star
Fecha: 2009-05-18 16:25:20
 

jennifer escribió:
hola solo quiero decirte q te quiero sigue luchando asi como bas ok bay
Fecha: 2009-05-21 21:06:51
 

natan aguilar servin escribió:
hola soy super fan d john cenna tengo 7 años y quiero decir q es el mejor y q recupere su campeonato muy pronto
Fecha: 2009-05-22 09:56:52
 

JOHN MICHAELS escribió:
OLA JOHN QUICIERA QUE ME VISITARAS SOY DE LAS VEGAS CHAO
Fecha: 2009-05-23 13:29:08
 

karla escribió:
john cena es el mejor de la wwe despues de jeff hardy ppor supuesto jajaja ademas d eque pelea muy bien es el papa de mi hermano y le doy gracias jaaa
Fecha: 2009-05-23 22:25:17
 

karen escribió:
john cena espero k estes soltero esta muy guapo esta buenisimo soy su fans me gusta cuando pelea y cen ..nu me ves!!!jaja
Fecha: 2009-05-24 15:03:41
 

MARCO escribió:
ERES EL MEJOR CENA SOY FAN NUMERO 1 ESPERO VERTE PELEAR SEGIDO CON TU TITULO
Fecha: 2009-05-24 15:25:17
 

zhaarhoonn escribió:
john Cena esta ermoozoo
Fecha: 2009-05-24 22:58:34
 

felipe sebastian escribió:
como eres tan fuerte
Fecha: 2009-05-25 16:55:24
 

felipe sebastian escribió:
tueres ran duro sal baste abatista
Fecha: 2009-05-25 16:57:08
 

john cena zuper fan escribió:
iop amo a john cena es super sexiiiiii y lindo es el mejor de la wwe zoi zu fan numero al = k otroz pero iop amo a john cena maz k a nadien
Fecha: 2009-05-25 18:22:09
 

felipe sebastian escribió:
ola cena medarias tu hotmail
Fecha: 2009-05-29 14:53:14
 

esmeralda escribió:
estas super guapo jone cenas besos
Fecha: 2009-05-25 20:05:57
 

JAVIER ARMANDO HERNÁNDEZ NOLASCO escribió:
es mi fans mas faborito de la wwe
Fecha: 2009-05-25 20:09:02
 

carlos cavl escribió:
hello, Cena, you are champeon wwe forever, soy de bolivia bay bay
Fecha: 2009-05-26 09:31:37
 

ju alberto escribió:
ola soi juan y yo opino k el es el mejor yo ya lo eeee visto en persona y va a ganar en exterme rules y le va aser el f u y puede k tambien el s t f u es el mejor de la wwe y rey misterio 619 619 619
Fecha: 2009-05-26 13:22:35
 

el principe demente escribió:
deberias volver a ser lo que eras un rapero luchador rapea en tus peleas
Fecha: 2009-05-26 14:05:59
 

lulu escribió:
hola cena tu eres el mejor de todos para mi eres el mas guapo que hay en la wwe sigue de guapo y fuerte me encanto cuando cargaste a big shou cuidate besos te quiero mucho soy tu fan numero #1 de mexico y de todo el mundo siempre beo tus perleas jeje cuidate muxo t.k.m mi nene jonh cena
Fecha: 2009-06-02 19:24:02
 

irene camacho angeles escribió:
HOLA ERES EL LUCHADOR MAS GUAPO DE LA WW Y MEGUSTAS MUCHO TE AMO.ERES TODO PARA MI.PARA MI NOEXISTE NADIEN MAS QUE SEA EL NUMERO 1 TE QUIERO MAS DE LO QUE TE IMAGINAS ADIOS.BONBON BESOS PON TELOS DON DE QUIERAS
Fecha: 2009-05-26 15:03:01
 

Nicole rodriguez diaz escribió:
john cena eres el lucha dor mejo de la wwe y el mas guapo y me gustas muho BYE. PAPASITO MUAAAAAAAAA
Fecha: 2009-05-26 17:09:19
 

dime laurel escribió:
gua JOHN CENA ES EL MEJOR NO SOLO DE LAS LUCHAS DE LA WWE SI NO DE TODO EL MUNDO ES GENIAL Y APARTE ES GUAPO YO LO PUEDO IR A VER MI TIO VIVE EN LOS ANGELES VAMOS JOHN CENA TU PUEDES CONTRA TODOS INCLUSO CON BIG SHOW (CREO QUE LE SUBIO A LOS TACOS BAI CUDENSE ESPECIALMENTE JOHN CENA
Fecha: 2009-06-08 14:35:58
 

valeria liliana escribió:
eres super luchas increible no me pierdo niuna de tus luchas eres
Fecha: 2009-05-26 18:19:28
 

valeria liliana escribió:
eres super luchas increible no me pierdo niuna de tus luchas eres
Fecha: 2009-05-26 18:20:33
 

green_nelly escribió:
oye quiero tu correo porque nunca de los nunca me pierdo tus tuchas son las mejore agregame a tu correo si o dame el tuyo contesta porfa
Fecha: 2009-05-26 18:23:38
 

green_nelly escribió:
oye quiero tu correo porque nunca de los nunca me pierdo tus tuchas son las mejore agregame a tu correo si o dame el tuyo contesta porfa
Fecha: 2009-05-26 18:24:17
 

andres escribió:
yo quiero combertirme en luchador y sigo tus pasos john cina y te vere el 30 de mayo en el palacio de los deportes
Fecha: 2009-05-26 19:19:32
 

alex escribió:
hola ermoso como estas solo quiero desirte que te amo y cuida temucho ok. y man dame tu correo te quiero mucho
Fecha: 2009-05-27 13:49:10
 

angelica escribió:
me encantaria poder charlar con John Cena, pues soy una de sus millones de admiradoras, me encantaria que el lo supiera, pues no hallo la manera de comunicarme con el. te quiero mucho
Fecha: 2009-05-27 20:13:23
 

yulissa escribió:
pzz john cena yo soy tu fans n1 por k me gusta como peleas y como ganas pero estas bien guapo sabes eres mi amor platonico y yo tengo miles de posters y fotos tuyas pero asta una mochila de ti y ojala vengas a matamoros tamaulipas por k voii a ir si vienes a apollarte como siempre pero si me tocas por lo menos la mano me desmayo bueno bayy ... t k m JOHN CENA el mejor k le ganas a todos bayy atte. yulissa
Fecha: 2009-06-02 19:37:16
 

tiffani escribió:
john cena ati te gana onde teyquer y rey misterioa y ademas eres una mariquita puñal loca frehfvdvhvbfv
Fecha: 2009-06-02 21:19:47
 

estefaniaa escribió:
pues hola zolo keria decirte k yo estefania te kiero decirte k eres el mejor delos mejores y k me gustas si kieres estar en kontacto con migo es PATITO_CHIKIS@HOTMAIL:COM
Fecha: 2009-06-03 20:53:41
 

JOHN LEE escribió:
JOHN CENA ES EL MEJOR LUCHADOR DE TODA LA WWE QUISIERA CONOCERLO SU CANCION DE JOHN CENA ES LA MEJOR DE TODOS Y LES DIGO MY TIME IS NOW
Fecha: 2009-06-05 22:36:24
 

maribel escribió:
john cena eres el mejor de todos los luchadores te quiero muc
Fecha: 2009-05-29 18:26:48
 

mich escribió:
john cena es el mas guapo
Fecha: 2009-05-30 10:02:16
 

ADRIAN CONSUEGRA CHACON escribió:
EY JOHN CENA TE QUIERO DECIR QUE ERES EL MEJOR DE TODOS ERES MI HIDOLO NUNCA ME DESCESIONAS AUN QUE PIERDAS ESPERO AL GUNDIA CHAT CONTIGO WORD LIFE
Fecha: 2009-05-30 11:18:09
 

maritza escribió:
john tHe aMo erezz el mejor tttteeee aaaammmmooo00oo0 estas super guapo....suerte con tus luchas te amo....
Fecha: 2009-05-30 11:24:12
 

maritza escribió:
john tHe aMo erezz el mejor tttteeee aaaammmmooo00oo0 estas super guapo....suerte con tus luchas te amo....oojala & te venges de randy orton por qe me caee super mall...agragame porfa marialexlamismaedad@hotmail.com espero tu respuesta.... TEEEE AMMOOO..
Fecha: 2009-05-30 11:27:11
 

luis escribió:
me desbelo siempre por verlos
Fecha: 2009-05-30 11:47:39
 

dayana escribió:
john cena eres guapicimo me encanta como peleas como actuas y recuerda tu puedes con todos los luchadores de la wwe mas y nunca perderas confio en ti ok cuidate muchisimo ok besos t.q.m. bie
Fecha: 2009-06-06 18:40:47
 

mauri escribió:
john cena yose q eres de estadons unidos pero yo te amiro mucho por q eres el mejor q este rey misteri pero tu mas adios
Fecha: 2009-05-30 18:16:37
 

mauricio escribió:
EY JOHN CENA TE QUIERO DECIR QUE ERES EL MEJOR DE TODOS ERES MI HIDOLO NUNCA ME DESCESIONAS AUN QUE PIERDAS ESPERO AL GUNDIA CHAT CONTIGO WORD LIFE
Fecha: 2009-05-30 18:18:24
 

karla escribió:
john cena eres un super luchador eres lo mas megor de las cuchas de la WWE ERES MUY GUAPO
Fecha: 2009-05-30 18:51:58
 

sol escribió:
ERES LO MEJOR JOHN CENA TE AMOOOOOOOOOOOOOOO I LOVE YOU!!!!!!!!!!!!
Fecha: 2009-05-31 14:35:31
 

anahi escribió:
la verdad john cena eres lo mejor aparte de guapo eres un buen luchador y los que no te kieren es por envidia soy de mexico
Fecha: 2009-06-08 19:17:06
 

PATRICIA escribió:
JOHN CENA eres el mejor en la WWE no saves cuanto me decespero cuando estas luchando pero si te dejo muy claro una cosa q aunq pierdas para mi tu ganaste ok ERES EL MEJOR aqui te deo mi email paty_9_95@hotmail.com BYE TKM CUIDATE
Fecha: 2009-05-31 17:06:56
 

leo escribió:
eres lo mejor de las luchas
Fecha: 2009-09-20 20:15:32
 

angel escribió:
Eres una de los peleadores que hace que la gente crea en ti cuyando esta peleando
Fecha: 2009-06-01 17:10:04
 

enyic escribió:
hola john cena te dygo algo eres EL MEJOR YO SOY UNA DE TUS FANS OK. TE KIERO MUCHO Y TE DYGO QUE ME KAI MAL VYQUI GUERRERO Y EL MARRANO DE BYG SHOU Y ATY TE KIERO
Fecha: 2009-06-01 21:09:44
 

la muñeka escribió:
ola john soy tu fan numero 1 ojala te pongas en contacto conmigo te amo john cena bueno bye bye
Fecha: 2009-06-07 17:36:35
 

john alex escribió:
eres mi idolo y quiero parecerme a usted soy hoper
Fecha: 2009-06-02 13:13:24
 

palomiita escribió:
cena eres el mejor sigue asi
Fecha: 2009-06-07 20:24:44
 

tiffany escribió:
eres el mejor john cena no sabes como me gusta verte pelear y ganar sabes que tu puedes contra big show solo piensa que tu puedes y no pienses en derrotas que para ti no existen y nunca existiran no olvides que te kiero mucho y que eres el mejor luchador de todos le guste a quien le guste ERES EL MEJOR QUE TODOS y tambien cuidate mucho bie
Fecha: 2009-06-02 15:29:41
 

EuNiCe DE JOHN CENA TE AMO escribió:
HOLA JOHN CENA ESTOY SUPERS ENAMORADA DE TI ERES LO MEJOR ERES EL MEJOR LUCHADOR Y EL MAS GUAPO
Fecha: 2009-06-12 18:57:15
 

Eunice escribió:
HOLA JOHN CENA ESTOY SUPERS ENAMORADA DE TI ERES LO MEJOR ERES EL MEJOR LUCHADOR Y EL MAS GUAP-O EMMM ESPERO Q TE PONGAS EN CONTACTO POR Q FALTA 2 MESE PARA MIS 15 AÑOS Y POS ACUPO Q BALLAS ME MUERO POR CONOSERTE TE AMO SOY UNAS DE TUS MEJORES FANS EN MI CELU TRAIGO PUERAS FOTOS TULLAS Q BAJO Y ME LAS PASASN X FAVOR JOHN CENA AGREGAME princesa_hemotza12@hotmail.com y mi celu es 6672662051 adios este marcame o mandame tu celu a yse hablar ingles asi q agregame adis t amo
Fecha: 2009-06-12 19:02:51
 

brenda escribió:
k ondas
Fecha: 2009-06-09 10:22:31
 

selena escribió:
cena i love you te amo como no te lo puedas imaginar bueno ojala y leas esto
Fecha: 2009-06-09 13:45:07
 

BRENDA GUADALUPE escribió:
HOLA YO ME LLAMO BRENDA TENGO 20 AÑOS VIVO EN MEXICO Y ESTOY BIEN BONITA Y QUISIERA CONOSERTE PORQUE ESTAS BIEN GUAPO Y ME ENCANTA COMO LUCHAS Y ESPERO QUE LE PUEDAS GANAR TU CINTURON EDGE Y NQUE ACABES CON BIG SWSHOU
Fecha: 2009-06-09 17:52:50
 

analidia escribió:
yonh cena eres lo mejor aunque todas las de mi salon estan lokas por ti te quiero atte ana te quiero bay te cuidas
Fecha: 2009-06-09 21:22:07
 

ana escribió:
yonh tengo poster de ti espero y un dia te vea aumque eso es solo un sueño bueno me boy muy desaNIMADA PERO JAMAS TE RENPLASARE TE QUIERO MUCHO TE CUIDAS AY DALE UNA PALISA A RADY ORTON BUENO TE DEJO MI MSN ANALIDIA1995H@HOTMAIL.COM
Fecha: 2009-06-09 21:30:49
 

celeste escribió:
!ESPERO QUE LO LEELO PLIS¡ ho0la john me encanta tu forma de ser yo creo que eres super lindo...bueno pliis¡ mandame tu msn me encantaria chatear con tigo pliss te lo agradeseria mucho a y de pasada pasame el de unos de tu amigos de la wwe sii grasias aa espero tu respuesta
Fecha: 2009-06-09 22:53:39
 

john alejandro beltran escribió:
hola john cena soy colombioano de un pais de gerra pero me gustaria conocerlo en persona gracias ate jhon alejandro
Fecha: 2009-06-15 20:25:07
 

Hector escribió:
john cena yo digo q eres el mejor de la wwe y eres mi luchador favorito
Fecha: 2009-06-11 13:15:40
 

david escribió:
john cena xfavor anexame este es mi correo davidgiron2009@hotmail.com soi de vicente oaxak anda te lo suplico anexame
Fecha: 2009-06-11 15:38:47
 

sarahi de cena escribió:
TE AMO JOHN CENA ERES EL MEJOR DE LAS LUCHAS Y ERES EL MEJOR SER HUMANO DE ESTE MUNDO SIEMPRE APOYANDO A LOS QE MEN0OS TIENEN ES POR ESO QE EL PUBLICO SIEMPRE ESTA CONTIGO ERES EL NUMERO UNO TE LO DICE TU FAN #1 PASAME TU CORREO EL MIO ES SARA_ALEJOYDANNY_20@LIVE.COM.MX
Fecha: 2009-06-11 16:35:51
 

gerardo escribió:
john cena es lo mejor !! ammm no tienes su correo ??? porfavor contestame zaludos :)
Fecha: 2009-06-11 18:08:39
 

tus admiradoras de tampico col more escribió:
hola como estas eres un bonbaso eres un luchador hermoso y estas hecho un bonbon te quiero y contestame te amamos
Fecha: 2009-06-13 15:46:00
 

mery bravo escribió:
HOLA JOHN CENA ERES LO MAXIMO NUNCA ME PIERDO TUS LUCHAS SOY TU FANS NUM UNO TE AMO ME GUSTAS MUCHOOOO.
Fecha: 2009-06-17 16:41:53
 

jose armando aduna soberano escribió:
john cena eres lo mejor mi hermana te ama y no te dejes ganar por big show.Mi hermana y yo siempre vemos las luchas bay.y no te lastimes mas,y ten cuidado con randi y algun dia ven a XALAPA por fa bai
Fecha: 2009-06-15 22:12:53
 

jesus escribió:
hola john cena yu eres la mejor persona del mundo eres para mi el mejoe luchador de la wwe eres el canpion ojala pudiera conocerte tu ers el numero 1 eres genial att tu atmirador pepe eres lo maximo adios
Fecha: 2009-06-14 16:21:03
 

sandra escribió:
hola john bueno solo quiero decirte que eres el mejor luchador y estas super guapisimo y todas las noches sueño contigo,ojala pudiera conocerte
Fecha: 2009-06-15 13:06:07
 

saday escribió:
ola hya q puedo decir de john cena esta super guapisimo me encantaria conocerlo personalmente me encanta su forma de luchar todo y lastima q no va a poder peliar con randi orton por el campionato de la wwe pero aun asi para mi es un ganador amo a john cena y para mi es le mejor de todos espero y estes bien y que gane muchos campinatos x q es el mejor besoz john
Fecha: 2009-06-16 10:08:12
 

MARISOL LOPEZ RAMIREZ escribió:
JOHN CENA QUIER DECIRTE K ERES EL MAS GUAPO DE LA WWE ME ENCANTAS ME FASINAS ERES UN BISCOCHO QUIERO CASARME CONTIGO SUEÑO CONTIGO ERES EL MEJOR NO TENGO PALA BRAS PARA DESIRTE TODO LO K SIENTO PERO EN UNA SOLA TE AMO VIVO EN MEXICO TE AMO BUSCAME ADIOS BUENOTE
Fecha: 2009-06-16 14:26:16
 

joanna escribió:
john cina eres lomejor luchador de la wwe
Fecha: 2009-06-16 20:02:45
 

ANA YANEZ escribió:
JOHN CENA,, PARA MI ERES LO MEJOR DE LOMEJOR ERES UN GRAN LUCHADOR TE ADMIRO MUCHOO Y POR NAADA ME PIREDOO TUS LUCHAS:D SE QUE NO SE PUEDE,, PERO SERIA GENIAL CONOCERTE... ERES BIEN GUAPO, Y OJALA Q TODO EL TIEMPO TE VALLA MUI BIIEN EN TODO LO Q HACES:P ERES EL MEJOR,, JOHN CENA!!!
Fecha: 2009-06-16 22:51:00
 

LUIS escribió:
SOY TU FAN NUMERO 1 ERES EL MEJOR DE TODOS LOS LUCHADORES DE LA WWE
Fecha: 2009-06-17 18:32:51
 

ADRIANA escribió:
HOLAAAA JOHN CENA TE AMO ERES GUAPISIMO Y EL MEJOR DE TODOS ERES LO MAXIMO TE MANDO MUCHOSS BESOS BAE CONTESTAME PORFIS
Fecha: 2009-06-17 19:17:03
 

Joanna escribió:
holaaaaa john cina eres el mejor luchador de la wwe tsmbien estas muy guapo tienes unas pompas geneale bueno me despido espero y me contestes muy pronto
Fecha: 2009-06-17 19:44:19
 

Alheli escribió:
GUAU! cena te admiro eres un chico super lindo en serio quisiera conocerte por que eres muy guap0 y ademas te amooooooo y ojala te vaya muy bien en la wwe que no te pase nada y toda la suerte del mundo. Dale duro al menso de The miz y al gordo de big show ja ja estubo muy padre el show que dieron aqui en monterrey y obvio asisti estube muy adelante para poder verte ten mucho cuidado por que van a empezar rivales como TRIPLE H Y RANDY ORTON. megustaria verte en persona pero creo que nunca se va a cumplir mi sueño te am000 con toda mi alma bye tkm
Fecha: 2009-06-18 15:35:51
 

francisco martinez escribió:
john cena es mi luchador favorito de la wwe esta bien chidocuando hace el stfu bueno bye
Fecha: 2009-06-19 13:56:36
 

Cuate escribió:
John Cena eres mi idolo desde q era pequeño porque ya tengo 14 oye un amigo del cole me dijo q cuando era bebe se tomo unas fotos contigo y su papa
Fecha: 2009-06-20 18:51:03
 

sandra escribió:
john cena es lo mejor de la wwe soy fan de el y kiero su correo
Fecha: 2009-06-25 19:53:57
 

emma escribió:
john cena estas bien buenoteeeeeeeeeeeee te abmiro mucho te amoooooooooooooooo y la que se te acerque le voy a romper la madre salñudame a batista y dile q el es elk amor de mi vida al igual q tu chiquito hermaso te ammmmmmmmmmmmmmmmmmmmmmooooooooooo sueño con besarte esa boquita soy tu fan numero 1 y un dia yo voy a ser una diva llamada emily ya lo veras y te podre besar ma nene hermaso a y tambien te amooooo batistaaaaaa vby unpoco a randy
Fecha: 2009-06-25 15:25:11
 

noe escribió:
mns el_nia@hotmail.com
Fecha: 2009-06-21 17:04:53
 

marisol escribió:
estas hecho un rico y el resto es vara ,,,,,,no quieres ser algo mas que un amigo dime que siiiiiiiiiiiiii
Fecha: 2009-06-26 10:19:45
 

andrea escribió:
john cena es el mejor de la wwe es mi idolo es el mejor y eso nunca cambiara. john cena siguele echandole ganas. eres el mejor de todos !!!!! atte:tu amiga andrea.... t.q.m
Fecha: 2009-06-21 20:46:45
 

kenya maria escribió:
john cena te amo eres el mejor de todo el mundo y de la wwe ganales a todos bueno ya me voy besos
Fecha: 2009-06-21 22:05:43
 

AZUCENA MAYORGA escribió:
pues solo pasando adesirte ke estas super mega guapisimoen serio eres el mejor de la wwe eres el meromero besossss tkm
Fecha: 2009-06-22 20:25:01
 

karina escribió:
mmmm me encanta john cena esta guapisimo
Fecha: 2009-06-22 21:34:07
 

karime escribió:
ola pues me encanta john cena lo adoro jejeje bye.
Fecha: 2009-06-22 21:59:33
 

MANUEL escribió:
hola john solo te pasaba a decir q eres chido soy tu fan 1 espero q me agreges mi correo es halo_manuel25@hotmail.com
Fecha: 2009-06-23 00:24:24
 

jimmy escribió:
soy tu idolo
Fecha: 2009-06-26 15:34:58
 

nahomi escribió:
love you john cena besitos
Fecha: 2009-06-23 19:18:53
 

rubi escribió:
ppzzzzzzzzzzzz john cena es el mejor
Fecha: 2009-06-23 19:51:12
 

BRANDO escribió:
JOHN CENA ERES EL MEJOR DE LA WWE SIEMPRE QUE JUEGO EN PLAY 2 WESTREMANIA TE ELIJO A TI PARA PELEAR
Fecha: 2009-06-24 13:47:50
 

david escribió:
eres lo major de las luchas no cambies
Fecha: 2009-06-28 12:48:37
 

yamilet te amo jhon cena escribió:
te amo me quiero casar con tigo si dises q no me interesa amor soy tu fans 1nunca me olvides te amooooooooooooooooooooooo.
Fecha: 2009-06-24 19:38:13
 

ANGELICA escribió:
HOLA JOHN CENA ERES EL MEJOR LUCHADOR DE LA LUCHA LIBRE ESTAS BIEN GUAPOTE EEEE QUISIERA CONOSERTE EN PERSONA ESTAS GUAPISIMO NO LO OLVIDES TE AMOOOOOOO
Fecha: 2009-06-24 19:41:31
 

vanessa guadalupe escribió:
ami me parece que john cena es el mejor luchador de todos ademas esta guapisimo como quisiera ser su novia ojala no este casado y tenga novia espero que algun dia me escriba me moriria si me escribe hay esta mi email bueno bye
Fecha: 2009-06-25 11:38:50
 

EL NETO escribió:
jhon cena soy el neto tu idolo muchos te tienen mucho envidia por que estas guapo y mejor luchador yeaaaaa... atentamente el netooooooo...
Fecha: 2009-06-25 12:08:37
 

gustavo escribió:
EL PELEADOR #1 DE LA WWE ATTE**GUS**.
Fecha: 2009-07-02 08:38:20
 

francisco david escribió:
podrian desir el nombre de francisco da vid garcia dias y que luche gran kali contra vicchou
Fecha: 2009-06-30 11:32:04
 

mayra escribió:
yo pienzo ke john cena es el mejor de todos los luchadores del mundo aunke algunos digan ke no es sierto para mi yon cena siempre ba a ser mejor ke todos los luchadores soy fan numero 1
Fecha: 2009-06-30 19:27:30
 

angelica escribió:
holaa cena tu ers el mejor y el numero 1 los dias q luchas no me pierdo en verte como lo aces espero q estes bye ok bye te cuidas i puedes me agresa mi e mail es gely_sagitario@live.com ok bye besitos muuuaac sigue siempre con la frent ya delante tu puedes ......
Fecha: 2009-07-02 16:53:48
 

nancy escribió:
jonhcina tu eres personaje preferida tengo todos tus poster fotos tu camisa tu cachucha
Fecha: 2009-07-03 18:40:46
 

NIDIA LIZETH escribió:
JOHN ESTA HERMOSO ME ENCANTA Y QUISIERA SABER SI ME PODRIA ESCRIBIR CENA ES EL MEJOR LUCHADOR DEL MUNDO HE IS BEATIFUL MAN
Fecha: 2009-07-07 15:12:38
 

juan escribió:
eres mi idolo
Fecha: 2009-07-07 11:46:12
 

karla escribió:
jhon cena eres el mas guapo de todo el mundo eres el mejor de la wwwe eres super te amare siempre
Fecha: 2009-07-07 18:24:29
 

selene alejandra escribió:
john cena eres mi idolo èspero que te encuentres en buenas condiciones..... eres el mejor de la wwe ... you can't see me .....tam♥♥♥♥
Fecha: 2009-07-07 19:12:38
 

paola escribió:
OIE JON CENA SOY TU MAYOR ADMIRADORA TENGO UNA FOTO EN MI METRO BNO TE VEO EN LA TELE
Fecha: 2009-07-04 15:53:44
 

ALEJANDRA escribió:
JOHN CENA ERES EL MEJOR D LA WWE S T F
Fecha: 2009-07-04 16:45:15
 

erika escribió:
ola bno aki paso nomas para saludar a mi hidolo k 3s john cena k 3s 3l m3jor luichador d3 la wwe bno ya m3 r3tiro no nomas des3arl3 todo lo mejor ok bno 1000 b3sos by3
Fecha: 2009-07-08 11:33:28
 

tere escribió:
HOLA JOHN CENA SOLO QUIERO QUE SEPAS QUE ESTAS GUAPISIMO PERO LA VERDAD YA ME ARDARON TUS FANS SIEMPRE SE LA PASAN SOÑANDO CON TICO Y YO CREO QUE NUNCA BAMOS A LLEGAR ACONOCERTE POR QUE NUNCA CREO QUE VENCAS A MEXICO Y SI LLECARAS A VENIR COBRARIAN MUY CARO PA VERDE ADIOS
Fecha: 2009-07-04 21:01:15
 

8 ANS escribió:
JONH CENA ET INVINCIBLES ACTER
Fecha: 2009-07-05 05:54:15
 

monica perez rios escribió:
*=)jonh cena eres sensasional estas bien guapote me encantas ami sobrino eduardo le pareses el mejor de los luchadores SUPER ERES EL NUMERO 1 =)
Fecha: 2009-07-07 22:21:06
 

liliana eunice te amo john cena escribió:
te amo john cena y espero ke estes bien te kiero mucho yo soy liliana eunice lara osuna del estado de sonora y escribo esto para decirte ke eres el mejor de toda la wwe nunca lo olvides ok........bye bye TE AMO...TE AMO...TE AMO.....♥♥♥♥♥♥
Fecha: 2009-07-09 18:14:11
 

susana martinez ramos escribió:
jonh cina eres mi idolo...y eres el mejor luchador de la lucha wwe........espero te encuentres muy bien cuidate mucho
Fecha: 2009-07-05 22:43:34
 

la noviaa dee John Cena escribió:
aver aver aver calmense todas que traen con mi novio?ee!! es miO! y de nadie mas jaja...aa y Carlos,Vero Y antonio son unos hijos de suu___________como se atreven a ablarr mal de john cenaa ee?? jaja buenoo todass yy a todoss loss fanss de JOHN CENA sii sabenn escojerr luchadoress ee!! jaja buenoo cuiidatee johnn cenaa jajaja
Fecha: 2009-07-08 17:11:35
 

selene alejandra escribió:
john cena te amo ♥♥ eres el mejor de la wwe te amo soi de sonora ojala dejes tu correo quiero chatiar contigo ••• teamo ♥♥♥♥♥♥♥♥♥ teamo teamo teamo nunca lo olvides•eres el mejor y no le agas caso a esos maletas jaja
Fecha: 2009-07-09 18:15:07
 

monica escribió:
estas guapisimo te beo siempre en LAS LUCHAS te amooooooo
Fecha: 2009-07-13 20:39:31
 

lisbhet escribió:
john cena hola soy tu mas grande fan no tengo todas tus cosas soy pobre vivo en mexico puerto vallarta jalisco y bueno en verdad no puedo crer que exsista al gien tatan perfecto eres genial eres el mejor no sabes como te admiro tengo 11 anos y eres mi idolo te amo te amo te amo y te adora lisbhet osea yo adios y sige siendo el mejor y pon en su lugar al tonto de big show ok bye y no olvides que te amo
Fecha: 2009-07-10 14:44:08
 

lisbhet escribió:
john cena hola soy tu mas grande fan no tengo todas tus cosas soy pobre vivo en mexico puerto vallarta jalisco y bueno en verdad no puedo crer que exsista al gien tatan perfecto eres genial eres el mejor no sabes como te admiro tengo 11 anos y eres mi idolo te amo te amo te amo y te adora lisbhet osea yo adios y sige siendo el mejor y pon en su lugar al tonto de big show ok bye y no olvides que te amo
Fecha: 2009-07-10 14:46:11
 

karina escribió:
JOHN CENA ERES EL MEJOR ME GUSTA COMO ERES I LO QE MAS ME GUSTA DE TI ES CUANDO ASES LA NO ME PUEDES BER
Fecha: 2009-07-10 17:21:13
 

juan escribió:
hello john cena this you good fan.
Fecha: 2009-07-10 22:48:07
 

victor escribió:
poos ere el mejor luchador y todos aqui en chetumal qroo mexico esperamos que ganes en night of champions el titulo de la wwe por fa te vemos todos los lunes por tvc saludos a todos cuidate camarada
Fecha: 2009-07-14 18:36:51
 

Diana laura sanchez dirzo escribió:
hola jonn cena yo soy diana de huitzuco,guerrero yo kuiero decirte ke eres lo mejor y no creasb los comentarios malos ke te dicen ADIOS jonn cena
Fecha: 2009-07-16 20:28:10
 

irlanda sandrina escribió:
xfa john cena pazanos tu korreo o el k lo tenga es mui important para todos nozotros todo tus fans somos el fan num 1 en especial io bueno io nazi el dia d tu nacimiento xfa dame tu korreo plizzz
Fecha: 2009-08-14 20:44:05
 

luis david escribió:
hola john cena yo soy tu fan numero1 y soy de papantla saludos
Fecha: 2009-07-17 13:27:35
 

fernanda escribió:
hola jon cena te amo estas super guapo t.q.m
Fecha: 2009-07-18 15:41:07
 

lucy escribió:
hola john cene soy lucy tengo 12 años y eres mi luchador favorito y eres guapo t.k.m eres super muchos besoooo0000s (bye)
Fecha: 2009-07-21 01:27:32
 

alejandra galindo escribió:
john cena eres el mejort luchado qe qonosqo te lo juro te admiro mucho te amo0o0o0
Fecha: 2009-07-22 17:37:05
 

joana escribió:
john cena es el mas guapo del mundo.lo amo soy su fan #i es el mejor esta hermoso me encantan sus ojos.me quiero casar con el.JOHN CENA TE AAAAAAMMMMMMMMMMOOOOOOOOOOOOOOOOOO Y T.K.M
Fecha: 2009-07-19 13:51:45
 

karla escribió:
john cena eres el mejor
Fecha: 2009-07-19 17:04:43
 

sonia abigail escribió:
johncenaeres muy guapo me encantas pero espero q me respondas
Fecha: 2009-07-19 18:14:02
 

ami escribió:
ers un buen luchador...............................................soy tu fan#1 eres el mejor de todos
Fecha: 2009-07-19 19:04:44
 

roxana villela martinez escribió:
eres el mejor john cena espero y ganes en capionato contra radi estoy cotigo. te quiero.
Fecha: 2009-07-19 21:44:41
 

estefany escribió:
johon como te gusta que te digamos papi eres el mejor y siempre lo vas a seguir siendo te amamos y te extrañamos regresa pronto te mandamos bendiciones tus hijos daniel y regina.
Fecha: 2009-07-23 15:02:18
 

jahaira escribió:
cena eres lo mejor
Fecha: 2009-07-23 15:28:23
 

criss escribió:
la netra soy tu fan n 1 todos los lunes te veo en smak dow peleas bien chilo
Fecha: 2009-07-24 18:11:45
 

criss escribió:
la netra soy tu fan n 1 todos los lunes te veo en smak dow peleas bien chilo
Fecha: 2009-07-24 18:10:28
 

BRENDA escribió:
HOLA JOHN CENA ERES LO MEJOR DE TODO EL MUNDO, LA GALAXIA Y EL UNIVERSO
Fecha: 2009-07-23 20:46:10
 

jenyfher escribió:
John Cena ere el mejor luchador yo quiero que me escribas a mi correo jenycs@live.com yo sueño con algun dia conocerte en persona yo tengo 14 años pero aun asi te adoro espero que ganes el campeonato de la wwe suerte
Fecha: 2009-07-25 15:21:43
 

jessica analy jimenez hernandez escribió:
john cena eres el mejor en todo el mundo y apesar de que estoy muy chavita te amo con todo el corazon y te deseo toda la suerte para que ganes el campionato de la wwe y otra cosa enviame una foto tuya autografiada besos te quiero
Fecha: 2009-07-23 22:35:55
 

yosse escribió:
JOHN CENA ERES EL MEGOR ESTAS GUAPISIMO TEAMO
Fecha: 2009-07-31 22:24:59
 

rikardo escribió:
q paso el 7septiempre q john cena es el mej or delos luchadores q en blas va aperdere randi orton el lunes va estar cena con el cinturon de la wwe
Fecha: 2009-08-05 20:16:14
 

fany escribió:
jhon cena eres el mejor luchador que aiga visto mi cuarto esta lleno de tus poster y sueño con algun dia conocerte en persona yo soy de mexico apesar de que estoy muy chava te adoro y espero que ese sueño se me cumpla
Fecha: 2009-07-24 14:50:15
 

luis vladimir escribió:
cna eres un gran luchador sige asi
Fecha: 2009-07-25 17:22:18
 

luis vladimir escribió:
cna eres un gran luchador sige asi
Fecha: 2009-07-25 17:24:10
 

HELEN FRANCO escribió:
JHON CENA ERES MEJOR ME ENCANTA JHON CENA Y OJALA PUEDA VENIR A MEXICO PARA VERTE SOY TU FAN N.1 ESTAS SUPER GUAPO Y PELEAS MUY VIEN ME ENCANTAS JHON CENA
Fecha: 2009-07-25 19:11:33
 

margarita escribió:
john cena eres un gran luchador y sabes que y sabes que tu eres mi campeon y yo soi tu fan n 1 tedeseo toda mi bida no me olbides teadoro bye
Fecha: 2009-07-25 21:03:39
 

rikardo aguirre armas escribió:
q paso el 7septiempre q john cena es el mej or delos luchadores q en blas va aperdere randi orton el lunes va estar cena con el cinturon de la wwe
Fecha: 2009-08-05 20:20:16
 

STEPHANIE DELONGE CENA ! escribió:
JOHN !! amOr miiO ! qeremOs qe vengas aki en PARAGUAY ! tOdOs te qeremOs ! te amamOs ! sOy tu fans #1! teee aMOOOO !
Fecha: 2009-07-26 13:52:29
 

sarai escribió:
hola yon dejame decirte que eres hermoso me encantas aparte claro que luchas muy bien cada vez que te veo luchar me tienes con el alma en un hilo gritando y pidiendo por que ganes porfa contestame a mi correo sarai0910@live.com.mx espero y vengas a sonora, mexico para conocerte en persona y poder agarrarte haaa.... algo mi rey smuk... besos
Fecha: 2009-07-26 14:04:51
 

e .isabel r.vla. escribió:
eres lo maximo y muy guapo papasita lo lees love you
Fecha: 2009-07-26 21:07:10
 

diana escribió:
JOHN CENA quisiera conoserte por que de todos los luchadores TU ERES EL MEJOR "de todos los de el mundo"te mando muchos besukos...........por cierto estas casado?
Fecha: 2009-07-27 19:02:40
 

octavio escribió:
jhon cena no pude ver night of champions pero es pero que ayas ganado y vengarte de orton espero que le ayas echo el no me puedes ver y la fu y tambien stfu y ganar el campionato de la wwe saludos.
Fecha: 2009-07-27 21:44:33
 

antonio miguel bernabe santiago escribió:
john cina eres el mejor de todos los luchadores de la wwe me justa como peleas y un favor dale un golpe de mi parte a randy orton y saludos a todos
Fecha: 2009-08-01 08:37:55
 

tacho escribió:
Eres el mejor de las luchas y quisiera que vinieran a méxico y pelen contra los de la AAA
Fecha: 2009-08-14 17:45:13
 

pame de republica domonicana escribió:
cena eres lo maximo eres lo mejor de la wwe!!!soy tu fans num.1...te adoroooooooooooooo sigue asi!!!cantas divino,actuas precioso y eres un exelente atleta!!!
Fecha: 2009-08-11 10:24:33
 

daniel escribió:
john cena espero que hayas ganado el campionato de la wwe y vengarte de randi orton y pateale el craneo eres como mi hermano moyor viva john cena el luchador de la wwe
Fecha: 2009-07-30 11:04:37
 

karla the cena escribió:
HOLA YO SOY KARLA THE CENA Y ME GUSTARIA CONOCERTE JOHN DE TODOS TU ERES EL MEJOR AUN QUE SEAN GRANDES COMO BIG SHOW Y OTROS ME GUSTARIA TENER TU CORREO OJALA Y TENGA LA OPORTUNIDAD DE VERTE CARA A CARA Y TENER TU CORREO Y TU CUANDO PIERDES ES POR QUE NO TIENES GANAS O POR QUE LES DEJAS GANAR ESA ES LA REALIDAD BUENO BYE ADIOSITO
Fecha: 2009-07-30 12:27:58
 

alexia escribió:
john cena eres el mejor de todos de la wwe y el + guapo y fuerte te amo
Fecha: 2009-07-30 13:45:31
 

maleny escribió:
hello john cena i love you
Fecha: 2009-08-21 21:23:38
 

JOSHUA escribió:
SOY TU MAYOR ATMIRADOR EL NUMERO 1 TEBEO TODOS LUNES Y VIERNES EN ROSTOLMENIA Y DIGANLE A MI MAMA QUE ME DEJE VER LA WWE DE JOSHUA PARA CENA LOS VEO DESDE EL DF
Fecha: 2009-08-01 16:30:21
 

Gilberto escribió:
eress el mejor luchador del mundo i de la wwe i me gustaria ke me dieras tu mns.. por favor bay.
Fecha: 2009-07-30 19:57:33
 

alejandra escribió:
JOHN CENA TE LO JURO ERES EL MEJOR LUCHADOR DEL UNIVERSO ERES UNICO SOY TU FAN NUMERO 1 YOU CANT SEE ME FU STFU Y MUCHOS MAS ARRIBA 12 ROUND THE MARIN Y EL RAP ASUI COMO TOMORROW MY TIME IS NOW WORLD LIFE ETC. TE AMO ESTAS SUPER GUAPO
Fecha: 2009-07-30 23:57:49
 

STEPHY DE CENA escribió:
WOW TNGO TANTAS KOSAS K DCIR K NOS X DOND EMPEZAR BUENO CREO K DBO EMPESAR X UN LINDO Y KORDIAL OLA SABES JOHNY T T PUEDO DCIR OLA VRDD VUENO PUES YOP T ADMIRO TANTO KOMO PERSONA X TU KARISMA POR TU LEALTAD KON TU PUBIKO EL UNTVERSO D LA WWE KOMO LUCHADOR Y ADMIRO ESO NO T AKOBARDAS KON NADA NI NADIE ERES GRAND WOW T AMO T ADORO T APRECIO ERES LO MEJOR D LO MEJOR MEN ... SE K TODOS T DEICEN LO MISMO AUNK ALGUNOS SON BOBOS Y T TIENN ENVIDIA PERO YO ECERIO T AMO ERES WOW NO TNGO PALABRAS PARA DECRIBIRLO NO ERES TAM PERFECTO KOMO PAPA DIOS PERO ERS UNO D LOS UMANOS MAS LINDOS D EST PLANTA Y SABS ERES MUY GUAPO Y LO KMAS M GUSTA D TI SON TUS OJOS, EN TU SONRIZA TUS OLLITOD K S T ACEN EN LAS MEJILLAS TODO TU M GUSTAS ERS TAN LINDO NUNK KAMBIES ABR KUANDO VIENS A VERACRUZ MEXIKO VUENO SIG ACIENDO EL YOU CAN´T SEE MY Y EL F U Y RECUERDA YO SI SOE LA FAN#1 DE LA PANDILLA D LA CADENA OSEA TU LEGION D SEGUIDORAS Y AUNK SE K ES UN 99%PROBABLE K NO LEAS ESTO SI ALGUN DIA LO YGAS A LEER T PIDO K PORFA PORFA NO TCASES KON TU NOVIA Y KASAT KON MIGO YO T ARE MUY FELIZ PRO VUENO NO SI TU ERS FELIZ CON ELLAKASAT CON ELLA O KON KIEN ESTES SEGURO D K T AGA 100% FLIZ Y ESO AMI Y A LOS K ENVERDAD T AMAMOS T ARA FELIZ Y SOLO DESEO K DIOS T BENDIGA SIEMPRE Y K ALGUN DIA SU MISERIKORDIA T ALKANSES Y NOS PODAMOS VER EN EL CIELO WI RWKUERDALO T AMO ADIOS KUIDAT Y UNA KOSA + SERIA BUENO K T UNIERAS KON HHH O ALGUIEN + X K AUNK NO LONESESITAS SE KUBRIRIAN UNO AL OTRO ANT LOS BOBOS KOMO ORTON Y SU BOBO LEGADO PERO BUENO ESA ES MI OPINION Y SI NO ENTIENDES TODO LO K ESCRIBI LLAMA A REY MISTERIO Y PIDEL XFIS K LO TRADUSK Y SALUDALO D MI PART BYE
Fecha: 2009-08-10 21:31:42
 

GLORIA PATRICIA TOVAR escribió:
JOHN CENA ERES UN SUPER PAPASITO, ME ENCANTAS Y ADEMAS ME PARECES QUE ERES EL MEJOR DE TODOS. SOY COLOMBIA QUISIERA TENER TU EMAIL, AHHH... Y LO MAS IMPORTANTE, SABER SI ERES SOLTERITO Y SIN COMPROMISOS, PORQUE LA VERDAD ME FASCINAS DEMASIADO.
Fecha: 2009-08-15 23:06:25
 

GERARDO escribió:
JONH CENA ERES EL MEJOR , TE ADMIRO MUCHO , TE DECEO TODO EL EXITO ADIOS Y QUE TE BALLA BIEN
Fecha: 2009-08-06 21:10:56
 

lupiitha de cena escribió:
love you cena tu eres el mejor de toda la wwe y tambiien el mas wuapo jehjehejeh yo soy tu mas grande fans y te amo love you cena
Fecha: 2009-08-07 09:55:02
 

katerin carollina avelar escribió:
eres lo mejor t.k.m
Fecha: 2009-08-08 14:15:17
 

pablo escribió:
jajajajajajaja dame tu correo john cena
Fecha: 2009-08-08 15:11:30
 

lupita escribió:
JOHN CENA ES EL MAS GUAPOS DE TODOS ES EL NUMERO 1 EL MEJOR
Fecha: 2009-08-08 18:11:02
 

Sharon escribió:
John Cena es el mejor luchador de la WWE esta super guapo y sobre todo te amo jajajaja suena loco pero es la verdad y todos los ke escriben pestes de el toooodo es metira bola de envidiosos porke ustedes no tienes lo ke el pudranse todos los envidiosos y John Cena es super
Fecha: 2009-08-09 12:40:48
 

mony escribió:
HOLA JOHN CENA COMO ESTAS TE MANDO ESTE MSJ DESDE MICHOACAN SIENDO TU FAN NUMERO 1 PUES TE LO MERECES TE QUIERO ESTAS BIEN GUAPO SIEMPRE ME DESBELO SOLO PARA VERTE LUCHAR ECHANDOTE PORRAS PARA QUE GANES EN LAS PELEAS Y AUN QUE NO LAS GANES SIEMPRE TE VOY APOYAR TENGO TODOS TUS POSTERS TODO HASTA MIS LIBRETAS ME GUSTARIA PODERTE VER EN VIVO EN LAS LUCHAS ESPERO ALGUNDIA PODER CUMPLIR ESE SUEÑO TE AMO MI JOHN POR FAVOR AGREGAME A TU CORREO BESOS MI VIDA.
Fecha: 2009-08-11 12:42:42
 

fabiola escribió:
john cena tu eres el mejor luchador de la wwe sabes tengo muchisimas ganas de conocerte mi cuarto este llenito de posters tuyos se todo de ti sigue asi te amo cena
Fecha: 2009-08-14 18:35:13
 

karla escribió:
hola john cena el lo mas guapo q puede haber en la wwe lo amo es mi mejor luchador de la wwe
Fecha: 2009-08-03 19:48:47
 

yinet escribió:
eres lo maximo dioste bendiga siempre mi amor y sigue adelante
Fecha: 2009-08-11 20:34:12
 

bere de cena escribió:
yo yo amooo a johnn cena daria mi vida por el lo juro si el se muere antes ke yo yo me muero con el se los juero por mi vidAa daria todo por john cenaaa lo juroo:) si tu lo ves john ilove you te amo john cenaaa
Fecha: 2009-08-11 21:50:36
 

NICOL escribió:
JOHN CENA ESTAS GUAPISISISMO ME ENCANTAS PAGARIA MILLONS POR UN BESO TUYO TENGO 16 AÑOS NUNCA ME ABIA GUSTADO TANTO TU HICISTE K SUSPIRARA TANTO POR UN NILÑO K SE PARECE MUCHO ATI SOLOK EN MORENITO Y QUE EL DESTINO NOS EPAROPOR K YO VIVO EN UNLUGAR Y AE EL SE LO LLEVSRON NO NLO EVISTO NO FUIMOS NADA PERO TENGO LA ESPERANZA DE ENCONTRARMELO UN DIA Y SER SU NOVIA Y VOLVIENDO AL TEMA TU ME GUSTAS ACES K ME ENCANTEN LAS LUGCHAS Y AL ESTAR ESCRIBIENDO ESTO FUI MUY SINCERA COMO AL ESTAR CON MIS AMIGOS Y DECIRLES K SI TU VINIERAS A COATZACOALCOS LODEAJRIA TODO POR SER TU NOVIA ES IMPOSI9BKLE PERO TE KIERO Y OJALA NO ESTES CASADO POR K ESO NOS DOLERA AMUCHAS CHAVAS Y NO SABES CUANTO TE KELE NICOL BESOS
Fecha: 2009-08-04 19:42:58
 

Anahi escribió:
hola john cena eres el mejor de todos desearia charlar contigo ♥♥♥ espero y me contestaras eres el mejor luchador del mundo nunca me pierdo ts luchas ............ eres el n. 1111111111 eres mi idolo te adoro soy tu fan n. 1111111111 tengo todo lo tuyo todititito tus fotos,posters, cuadernos, etc... te admiro ers el mejor T.Q.M ♥!♥!♥! JOHN CENA T.Q.M.♥!♥!♥!
Fecha: 2009-08-04 22:59:25
 

MONY escribió:
hola john QUIERO DECIRTE QUE ERES EL MEJOR TE AMO ESTAS BIEN GUAPO SOY TU FAN NUMRO 1 TENGO TODOS TUS POSTERS TE ADMIRO MUCHO ESTAS BIEN BUENOTE ME ENCANTARIA DARTE UN BESO NUNCA ME PIERDO LAS LUCHAS SOBRETODO CUANDO SALES TU NO ME IMPORTA DESVELARME SI TE VOY A VER CON ESO ME QUEDO MAS QUE CONTENTA BESOS OJALA Y ME AGREGUES TE AMOOOOOOOOOOOO!
Fecha: 2009-08-12 13:22:08
 

karla escribió:
hola quiero decir ers el mejor soy tu fan numero 1 JHON CENA TE ADORO ME GUSTARIA CONOCERTE AYYYY NOSOLO SOY FANATICA TUYA SINO TAMBIEN DE LA WWE NO ME LA PIERDO LOS LUNES NI LOS JUEVES NI LOS VIERNESTE QUIERO MI FANATICA ES MARIA Y MARYSE TE ADORO ADIOS
Fecha: 2009-08-12 19:13:39
 

lalo escribió:
hola cena soy de puerto vallarta soi tu fan numero 1 dame tucorreo adio bay cudate
Fecha: 2009-08-13 15:48:43
 

karla escribió:
hola soy otravez yo esque en verdar me traes de cabeza ah porfavor contestame eres el numero 111111111111111111111111111 eres guapisimo te adoro karla
Fecha: 2009-08-13 17:56:10
 

cecilia duran escribió:
sabes jhon bueno primeramente hola como estas.... sabes soy tu fans numero uno esque eres una persona increible eres el mejor mas bien dicho....si en alguna parte del mundo a alguien no le cais bien seria un tonto porque es difisil que una persona como tu le caiga mal aunque sea una mosca...eres el mejor de la wwe siempre estare de tu lado sabes mire tu pelicula la del marino y me super encanto estaba sensacional eres lo maximo de lo maximo..te podria decir monton de cosas pero solo basta con decir que eres el mejor en todo sentido es decir que eres el mejor en cualquier cosa que agas...recuerda que en mi siempre bas a tener una amiga que siempre te ba a admirar y no solo porque eres grandioso si no porque le cais bien a cualquiera.y sabes si en algun lugar del mundo hay una persona a la que no le caigas bien esta mal pero realmente creo que no los hay bueno me despido tu amiga que te quiere sandra cecilia cuidate bye.......
Fecha: 2009-08-21 19:29:32
 

diana gabriela soto flores escribió:
eres todo un papasote qisiera conoserte y eres el campion de la wwe y todas las noches me quedo despierta solo para ver tu linda cara y derrota a todos tu puedes eres el mejor ermoso te amo aunque tu no me conoscas te llevare en mi corazon por toda mi vida te amo te amo te amo y siempre te seguire amandoo papasote eres un erue para mitu cres
Fecha: 2009-08-16 16:25:02
 

diana gabriela soto flores escribió:
eres todo un papasote qisiera conoserte y eres el campion de la wwe y todas las noches me quedo despierta solo para ver tu linda cara y derrota a todos tu puedes eres el mejor ermoso te amo aunque tu no me conoscas te llevare en mi corazon por toda mi vida te amo te amo te amo y siempre te seguire amandoo papasote eres un erue para mitu cres
Fecha: 2009-08-16 16:27:30
 

pepe escribió:
john es el mejor randy orton va a perder john cena wwwwwooooo you cant see me
Fecha: 2009-08-16 20:36:52
 

elian omar flores agundis escribió:
john cena es mi luchador #1 tengo todo de john cena ojala que gane siempre you cant see me hustle loyalty respect
Fecha: 2009-08-17 10:57:59
 

moises yair escribió:
te Admiro mucho john cena eres el mejor de todos de la wwe quisiera poder conocert en persona eso seria un gran sueño te aprecio eres el mejor bye cuidat y si puedes dam tu correo electronico y yo ya t di el mio darkcear_05@hotmail.com xfavor damelo o agregam please
Fecha: 2009-09-01 15:50:11
 

karla escribió:
hola porfavor contestame porfavorte admiro mucho ok adios ers el mejor
Fecha: 2009-08-17 15:04:19
 

franciscojavier escribió:
yopienso que elmejorluchador de la wwe
Fecha: 2009-08-17 18:11:46
 

Rocio escribió:
Hola Chicas y chicos, saben cuantos años tiene John Cena? Si tiene mas de 20 años, o ke rollo diganme porfis, me llamo Rocio y soy de Chihuahua, chih. Mexico, yo no conocia a John hasta que lo vi en una piñata de un primo mio. Con tu cachucha John te ves guapo, mas que los asquerosos de Cibernetico, y mas que mi vecino de enfrente, jejeje.
Fecha: 2009-09-23 18:32:42
 

miriam escribió:
ola john kisiera k me dieras tu correo soy tu mejor fan nunca me e perdido una lucha tuya me lo darias porfis
Fecha: 2009-08-18 15:01:19
 

janeth guadalupe villa contreras escribió:
john cena eres lo maximo luchas chido sigue asi ganando bay
Fecha: 2009-09-23 12:09:49
 

laura escribió:
hola solo queria decirte que eres el numero 1 que estas como quieres que tu solo eres mio que no lo olvides que todos los mdias te veo mi amor y no te voy a olvidar mi amor t.q.m
Fecha: 2009-09-14 20:41:14
 

catherine escribió:
ola jonh cxena quirro tu correo yo soy tu fan numero uno y tengo tu playera y gorra y nuñequeras te quiero
Fecha: 2009-09-06 12:49:24
 

ººviri de cena*** escribió:
JOHN CENA ES UN GRAN ACTOR , CANTANTE Y LUCHADOR ESPERO Q LLEGUE A TENER SU CORREO. BYE
Fecha: 2009-09-06 16:34:00
 

DULCE escribió:
we are you wold tu sabes no
Fecha: 2009-09-07 18:46:16
 

LIZETTE XIOMARELI Y SIXTO HUMBERTO escribió:
JOHN CENA ERES EL MAS GENIAL SOY TU SUPER FAN. ESPERO QUE ME MANDES TU CORREO PARA ESTAR MAS EN CONTACTO Y ERES EL MEJOR .MUCHOS SALUDOS DESDE TAMAULIPAS
Fecha: 2009-09-07 23:26:32
 

karina escribió:
OoooLa john cena soy una fanatica tuya a y te quiero conocer poreso aqui te dejo mi correo karina_1503@live.com sabes eres el mejor y tu le vas a ganar a randy orton porq eres el mejor de we t.k.m adios te conctas adios john cena
Fecha: 2009-09-08 19:36:45
 

brenda escribió:
john cena eres muy guapo pero tu novia esta bien fea ya parese abuelita piensa cena que si te casas vas a perder muchas fans
Fecha: 2009-09-09 13:16:13
 

MOISES escribió:
JOHN CINA ESLOMEGOR DE LA WWE ERESMIMEGOR AMIGO ITAMIRO MUCHO
Fecha: 2009-10-01 22:10:52
 

blanca estela escribió:
john eres el mejor luchador de la wwe mencanta como peleas eres super guapo nunca me pierdo por nada delmundo cuando peleas bueno sigue luchando asi de exselente eres el mejor by
Fecha: 2009-09-24 15:46:49
 

PRISCILITA DE CENA escribió:
HOLA KE TAL YO CREO KE JOHN ES EL MEJOR LUCHADOR DE LA WWE Y DEL MUNDO ME ENTANESOS JOS AZULES KE TIENE YO NO CREO KE SE META DROGA KREO KE ES DE MASIADO LINDO ES SINSERO Y GUAPO ME DERRITO POR EL ME EN CANTAS JOHN CENA . I LOVE JOHN CENA. JOHN CENA: prisa, lealtad y respeto .
Fecha: 2009-09-13 18:51:25
 

liliana jimenez escribió:
hola john estas bien bueno y guapo no agas caso o loq te dice el mentado carlos es pura envidia y randy orton no teba ganar te deseo lo mejor mandanos saludos en la tv a la familia jimenez arias
Fecha: 2009-09-24 15:06:10
 

donovan escribió:
jon pasame tu correo y no le digo a nadie el mio es dono-capricornio@hotmail.com pasamelo porfa
Fecha: 2009-09-26 16:24:13
 

brenda escribió:
hola soy maximino y eres mi idolo cina tengo todo tuyo soy tu idolo.de maximino
Fecha: 2009-09-28 17:58:07
 

andrea escribió:
jonh cena eres el mejor
Fecha: 2009-09-27 10:55:03
 

Rodrigo escribió:
John Cena es el mejor luchador del mundo, y los q' no lo creeen es por q' estan celosos. John Cena tu mandas, no hay nadie quien te vensa, tu puedes con todos, VIVA JOHN CENA.
Fecha: 2009-10-01 15:46:46
 

zulma daza carranza escribió:
jhon cenas me gustas tu forma com peleas y eres un chico muy lindo poreso te coloco 5 angelito com mucho cariñooo para tiiiiiiiiii de fansa zulma
Fecha: 2009-09-19 12:14:34
 

liliana jimenez escribió:
hola john estas bien bueno y guapo no agas caso o loq te dice el mentado carlos es pura envidia y randy orton no teba ganar te deseo lo mejor mandanos saludos en la tv a la familia jimenez arias
Fecha: 2009-09-24 15:10:14
 

jazmin escribió:
te AMO ERES EL MEJOR JHON CENA OJALA Y TE CONOSCA MUY PRONTO NUNCA DEJES DE SER EL HOMBRE DEL AJUSTE DE ACTITUD
Fecha: 2009-09-16 16:29:11
 

soy tu admiradora escribió:
mira la vdd tlvez ni leas este maj, pero de todos modos si es cierto que te tomas la molestia de consultar estos mensajes, quiero decirte que me gustas en este momento recuerdo la primera pelea en la que te vi y tienes un cuerpo perfecto de hecho te tengo el pantalla en este momento bueno cena, en tu proxima pelea desearia que me dijeras amor y paz. me encantas todo tu besitos a y tengo 25 amor y soy de sonora.
Fecha: 2009-09-27 18:44:01
 

paty escribió:
sinceramente eres un bombon mas que nada eres un sueño para todas no nadamas para mi todas quizieran tener un bombon como tu bueno eso pienso yo no se que piensen las demas te amo eres lo maximo toda mujer deciaria estar contigo porque yo en lo particular he pensado eso te amo te adoro eres mi ilusion eres todo para mi adios john cena att paty
Fecha: 2009-09-17 17:46:08
 

Rodrigo escribió:
John Cena tu eres el mejor de la wwe y del mundo, te ADORO, no sabes cuanto daria por un autografo tuyo eres lo MEJOR.
Fecha: 2009-09-30 17:15:59
 

dorians escribió:
te amo john cena y kelly kelly eres mi idola como no eres novia de jonh cena
Fecha: 2009-09-30 16:23:00
 

raul de la rosa escribió:
Antes que nada saludos muchos saludos tienes que ganar la pelea con radi orton te apollo al cien por ciento echale todas las ganas tu puedes derrotarlo espero siempre verte bijente ok tu amigo Raul De La Rosa...
Fecha: 2009-10-08 21:19:15
 

monica escribió:
tekelo mxo eres el mejor pasame tu msn
Fecha: 2009-09-19 00:23:00
 

lizzet la novia de john cena la unica escribió:
eres el mejor de wwe me gustaria que vinieras a veracruz y espero algun dia conocerte te amooooooooooooooooooooooo y yo soy la unica que te ama de verdad y acuerdate nunca dejar de ser el hombre del ajuste de attitud te amoooooooooooooooooooooooooooo atte.lizzet tu novia para toda la vidaaaaaaaaaaa
Fecha: 2009-10-07 19:16:18
 

daysi escribió:
daisy si llegas a meterte a esta pagina yo te lo escribi hola john savias algo ares el mejor de la wwe te amooooooooooo , te quieroooooooo soy tu fans 2 por que mi amiga liz es la numero 1 auque no lo crean es la mejar te amoooooooooooooooooo atte. daysi
Fecha: 2009-10-07 19:22:23
 

nancy escribió:
john cena eres el mejor luchador de la wwe. estas muy guapo cuidate bye
Fecha: 2009-10-03 16:55:32
 

anahii escribió:
john cena es el mejor es todo lo k una mujer kiiere tener.con el sii perderiia mi virginidad..te amo0 eres el mejor.cena eres el mejor luchador le duela a kien le duela... quiiero casarme con tiigo te amoo eres el mejor.te amo te adoro eres el mejor y eres una fantasiia sexual para todas la mujeres...te amo
Fecha: 2009-10-03 18:05:24
 

anahii escribió:
john cena es el mejor es todo lo k una mujer kiiere tener.con el sii perderiia mi virginidad..te amo0 eres el mejor.cena eres el mejor luchador le duela a kien le duela... quiiero casarme con tiigo te amoo eres el mejor.te amo te adoro eres el mejor y eres una fantasiia sexual para todas la mujeres...te amo
Fecha: 2009-10-03 18:06:49
 

paOlaa escribió:
I LOVE JOHN CENA QUIERES CASARTE CON MIGO AUNQUE TENGAS 32 YEARS YES YES...
Fecha: 2009-10-03 18:09:25
 

esther escribió:
ERES DE LO MEJOR KISIERA KONVERSAR KON TIGO I LOVE eres lo mejor de todo eres lo mejor en la wwe y tu fisiko tambien es lo mejor y nuevamente i love
Fecha: 2009-10-03 21:18:21
 

lizzet escribió:
john cena eres el mejor de la wwe te quiero y te amo todos te queremos eres el mejor te amoooooooooooooooooo atte.lizzet
Fecha: 2009-10-04 13:41:16
 

rocio escribió:
jonh cena eres el mejor luchador del mundo bay.
Fecha: 2009-10-12 22:05:22
 

lizzet tu amor unico john escribió:
jonh cena eres el mejor de wwe te amoooooooooo y tengo una amiga que tambien te amaaaa espero cuando bengas a veracruz te amooooooooooo y nunca lo olvides que todos te amamos eres el mejor ojhn cena te amooooooooooooooooooooooooooo
Fecha: 2009-10-09 20:06:06
 

EVELYN GARCIA ESPINOZA DE CENA escribió:
NO ME IMPOR SI EZTA CASADO Y YO LO AMO EZO ZI ME INTEREZA HE
Fecha: 2009-10-08 18:23:23
 

VANESSA DE CENA escribió:
ERES EL MEJOR TE AMO CENA CHULO DE PRESIOSO Y QUITALE EL TITULO A ORTON BESOS TODO GUADALAJARA TE AMA CHIQUITO PAPA BESOS DONDE TE LOS QUIERAS ACOMODAR
Fecha: 2009-10-18 21:34:48
 

oscar escribió:
jhon cena tengo todo de ti siempre te veo en las luchas y soy tu fan numero 1 y tu eres mi hidolo quiero tu correo el mio es oscargtasanandreas100@hotmail.com a y te quisiera conocer realmente y quiero tu autografo
Fecha: 2009-10-23 21:27:48
 

marlen escribió:
woooow john cena es lo mejor neta es el super tiene algo que no tiienen los otros luchadores algo que lo hace ver muy muy diferente y me encantariiia conocerte eres lo mejor neta eres chiido super woooow tkm
Fecha: 2009-10-17 13:21:42
 

ANALLELI escribió:
hola tequeria desir que me gustas mcho pero ya se que no te podre conoser nunca teamo a yseme olvibarme despedirme adios
Fecha: 2009-10-15 21:54:03
 

sharon escribió:
hola john cena espero q no estas casado ni tengas hijos por q eso nos dolera mucho alas chavas q te queremos mi mejor deseo es conoserte y q me marques ami casa 58569145 cuidate mucho
Fecha: 2009-09-26 19:24:51
 

josue escribió:
jhon cena jajajaj me tete con un calibre grueso como estos 10 pociones 1 underteker 2 batista 3 umaga 4 gran cali 5 kane 6 hhh 7 rey misterio 8 cm punk 9 big show 10 jeff hardy y el colado matt hardy
Fecha: 2009-10-08 21:04:43
 

kathia yomara figueroa montaño escribió:
hola john cena te deseo suerte para la pelea con randi orton tqm cuidate adios eres el mejor
Fecha: 2009-10-07 15:20:56
 

oscar alejendro escribió:
jonh cena tu eres un luchador de los maz favoritos de loz mios!!!!! y kisiera tu correo electronico el mio es oscar_sharkix@hotmail.com y ademas yo kisiera tener el cuerpo igual ke vos
Fecha: 2009-09-29 22:26:24
 

FREZIZX escribió:
hola mi amorzito ozea komo t daz kuemta zoy tu fans ozea num. uno la neta eres genialllllllll ozea lo q l zigue d gnial. JoHoN cEnA TkM ZIGUE ZIENDO EL MEJOR D LA WWE. BUENO BYE T MANDO MILEZ D KISSSSSSSSSSSS
Fecha: 2009-10-21 15:09:12
 

beetzy escribió:
john cena el mejor de la wwe ojala lo seas forever soy tu idola nomber 1 mi sueño en la vida es conocerte ojala leyeras estos comentarios de todos nosotros estoy segura que te voy a ir a ver kuando vengas a monterrey. te quiero mil y ojala seas siempre el champion de la wwe te amo cena.S2 KISS
Fecha: 2009-10-09 00:07:25
 

esly escribió:
ola amor soy thu fans numero uno john cena eres el mejor bno kisiera saber si me pudieras dar thu correo madelo porfavor si ok bae
Fecha: 2009-10-19 11:04:52
 

maleny escribió:
ps te deseo lo mejor sigue adelante y muchas felicidades y dice mi hermano que quiciera tener los brazos como tu y eres el mejor no lo olvides john cena
Fecha: 2009-10-27 17:16:17
 

amalia escribió:
Hi john cena yuo is nicce person, I LOVE ........ bye kises,kises
Fecha: 2009-11-05 18:14:12
 

daniel haran escribió:
JOHN CENA ERES EL MEJOR LUCHADOR DEL MUNDO Y CUANDO PELIES POR EL TITULO DE LA WWE ESPERO QUE GANES PORQUE LOS DX SI TE PUEDEN DERROTAR ECHALE MUCHAS GANAS Y GANALES ATENTAMENTE LA FAMILIA ESPARZA OCHOA.
Fecha: 2009-11-02 19:48:12
 

angel de jesus escribió:
eres lo maximo, ponle a triple H
Fecha: 2009-11-03 13:09:57
 

06747899 escribió:
john peut ne tuer je l'aime
Fecha: 2009-11-18 07:44:46
 

ana maria eguino escribió:
tu eres el mejor luchador de wwe porfas kiero tu korreo lo voy aesperar
Fecha: 2009-11-04 21:13:57
 

diana judith escribió:
de tanto estar enamorada de ti no me ppuedo concentar en clases y mi sueño es hacer una pelicula con tigo y me gusta todo de ti y tienes buen trasero
Fecha: 2009-11-03 22:42:51
 

alonso y sabrina escribió:
john cena te adoro poreso pieso que nsesito tu correo soy tu admirador alonso tiene todo su cuarto pegado de poster tuyos no desepsiones al niño que tanto te quiere y te admira practica lucha con sus almuadas de vez en cuando con sus hermanas antes no lucha con su mama porfabor dale tu corro al niño que tanto te admira ATTE:ALONSO Y SABRINA MAS QUE NADA ALIONSO
Fecha: 2009-11-16 10:06:15
 

MONSE escribió:
TE AMO JOHN CENA ME ENCANTA CUANDO LE DAS SU MERECIDO A RANDY ORTON ERES SUPER GUAPO ME GUSTA TODO SOBRE TI (TODO) TE AMO BYE
Fecha: 2009-11-12 14:29:54
 

alex escribió:
eres lo mejor de los luchadores y te deseo que siempre seas el mejor luchador de la wwe
Fecha: 2009-11-09 12:20:17
 

valeria escribió:
john cena te kiero tanto ke a nadie le ago caso ps te kiero un chorro q me gustaria conocerte eres el mejor campeon que eeeeee konocido besos
Fecha: 2009-11-17 15:09:09
 

dulce escribió:
Hola eres el mejor luchador y eres el campion de la wwe
Fecha: 2009-11-17 15:34:24
 

ana karen escribió:
eres un papucho hermoso tequiero conocer undia de estos porfis teama karen tufans numero uno "1" ya sabes adios ben a monterrey.t.k m xoxo good baye
Fecha: 2009-11-17 19:01:37
 

miriam escribió:
lalucha esta de poca ovio y john cena es mio y de nadie mas bay
Fecha: 2009-11-15 13:48:16
 

MERY RUTH escribió:
jhon cena eres el mejor de todos los luchadores siguí ganando siiiiiiiiiiiii bay
Fecha: 2009-11-15 18:08:49
 

sergio escribió:
john cena eres buen luchador muy bueno pero hbk es mucho mejor que tu ok y saludos
Fecha: 2009-11-18 18:13:08
 

luana escribió:
no te cases, casate con migo me esxitas cada vez que te veo luchando, soy panameña
Fecha: 2009-12-08 13:50:07
 

alejandro gabriel escribió:
vueno solo quiero q sepas que tu eres el unico y que nadie te llega a los talones ¡¡¡¡¡¡¡¡¡¡¡¡¡te cuidas men!!!!!!!!!!!!!
Fecha: 2009-12-14 13:35:38
 

adriana escribió:
yo kisiera decir q JONH CENA es el numero 1 me encanta son su FAN me encantaria conocerlo auq digan loq diga solament tienen celos algunos xq JONH cena esta demaciado GUAPO pero yo digo eso no tiene nada d malo ser GUAPO no es defecto es una virtud y el la tiene pero el es un gran luchador eso es lo q me interesa a mi es mi favorito me encanta como luchas JONH CENA T AMO MUCHOOOOOOOOOOOO BYE
Fecha: 2009-11-23 14:15:55
 

flor ivonne escribió:
yo solo pienso q es el mejor hombre del mundo,aparte de q es el campeon de la wwe y todos le tiene envidia pero espero y siempre exista x q es super para mi es especial ok.y acuerdate de mi ehi esta mi correo espero tu mensaje
Fecha: 2009-11-26 20:31:25
 

enedina escribió:
john eres lomejorde sde la wwe. te quiero mucho cuidate te mando muchos besos
Fecha: 2009-11-26 20:46:05
 

JHISEL escribió:
JOHN CENA ERES UN HOMBRE FENOMENAL TE IDOLATRO MI MAYOR DESEO ES CONOCERTE ESPERO ALGUN DIA MI DESEO SE CUMPLA
Fecha: 2009-11-27 11:14:12
 

angel escribió:
hola cena eres el mejor luchador espero q te conectes con migo espero u rsuesta
Fecha: 2009-11-27 12:15:06
 

magui escribió:
porque nohay videos de cuando canta jonh cena en el inernet alguien me puede decir
Fecha: 2009-11-27 13:32:09
 

magui escribió:
espero te conectes conmigo Jonh
Fecha: 2009-11-27 13:34:36
 

edgar cena escribió:
john cena eres lo maximo nadie puede superarte y se q noquearas a sheymus
Fecha: 2009-12-03 17:49:40
 

cintia yamilet avendaño perez escribió:
JOHN CENA ES EL MEJOR DE LA WWE ES EL MAS GUPO DE TODOS LOS LUCHADORES EL MAS CARISMATICO EL MEJOR DEL MUNDO ES UN BUEN LUCHADOR ADEMAS KANTA LINDICIMO SOLO POR EL ESTOY APRENDIENDO INGLES KISIERA ALGUN DIA KONOCER LO ES PERO Y ESE DIA YEGE Y KUANDO YEGE SERIA EL MEJOR DIA DEMI VIDA POR KE JOHN CENA ES EL MEJOR WILL NEVER LET YOU GO
Fecha: 2009-12-04 23:17:22
 

JESSICA escribió:
!HOLA JOHN¡ YO DESDE KE ERA CHIKITA E QUERIDO CONOSERTE PERO PUES CADA QUE ESTAS AQUI EN MEXICO NO TE PUEDO HIR A BER POR UNA U OTRA COSA YO DARIA TODO POR CONOSERTE ES MI SUEÑO DORADO ERES EL MEGOR DE TODOS ESTAS ECHO UN MANGASO DE TI ESTOY APRENDIENDO Y ESPERO YAGAR A CONOSERTE ALGUN DIA ADIOS TE AMOOOOOO JOHN CENA
Fecha: 2009-12-05 13:47:05
 

michel escribió:
QUIERO CONOSERTE Y DESIRE LO QUE TE QUIERO Y INITRTE AL CINE ME AGREGAS
Fecha: 2009-12-11 15:29:05
 

alberto escribió:
eres mi fan numero uno todos los lunes te veo como le ganas te a randy orton y a cm punk espero que lo veas
Fecha: 2009-12-15 17:27:35
 

luis escribió:
SOLO QUIERO DE SIR QUE JOHN CENA ES EL MEJOR LUCHADOR DE WWE Y QUE SOY EL FAN #1 Y QUE KELLI KELLI ES LA MAS BONITA DE LA WWE
Fecha: 2009-12-15 17:38:56
 

yuli escribió:
eres el mejor del mundo yo antes ni te conocia pero esres un biscocho eres casado porque yo me casaria con tigo te quiero espero que algun dia vengas a mexico bye erez lo maximo
Fecha: 2009-12-18 12:51:21
 

maria de los angeles escribió:
Cuando veo en te a john cena se me sale la baba por q esta super guapisimo si no esta casado y tampoco tiene novia q se venga a monterrey para q vea como estamos las mujeres regias y a lo mejor encuentras algo aca ojala q te anime ok
Fecha: 2009-12-13 17:43:40
 

Jessica escribió:
jaj porquee le escriiben como si lo fuera a leer jaja el no lee estas cosas y aunque quisiera no puede hacerlo, miren que john no habla español hhahhahhahhaaa se pasaronn hhahha aunquee es muy sensual
Fecha: 2009-12-15 19:45:20
 

yuli escribió:
eres el mejor del mundo yo antes ni te conocia pero esres un biscocho eres casado porque yo me casaria con tigo te quiero espero que algun dia vengas a mexico erez lo maximo ´pero porque perdiste pero espero que algun dia les ganes a todos bye
Fecha: 2009-12-18 12:53:41
 

angel escribió:
hello cena tu eres el mejor luchador de la raw soy tu acmirador estaria muy feliz si medas tu correo electronico y tu eres el campion cuidate
Fecha: 2009-12-17 10:24:09
 

santy escribió:
hola john cena vos sos mi idolo yo soi santy vos pelias en 100 por ciento lucha por que salis en los juegos............
Fecha: 2009-12-17 14:46:42
 

jesica escribió:
hola
Fecha: 2009-12-17 16:24:26
 

yesica escribió:
es el megor del mundo y lo amo atte yesica osea yesser toledo
Fecha: 2009-12-17 16:32:37
 

daniel rodriguez rodriguez escribió:
jonh cena eres el mejor mi mama esta loca por ti jajaja pero porqe perdiste en tlc lore porque ya no tienes el titulo pero pronto sera tullo de nuevo vas a ver¡
Fecha: 2009-12-17 22:27:27
 

kevin escribió:
hola jonh cena soy kevin soy de huatabampo sonora eres mi luchador favorito de la wwe hata tengo tu camiseta de never give up espero que me mandes tu e-mail gracias bye
Fecha: 2009-12-19 16:46:59
 

daniela escribió:
hola cono estas
Fecha: 2009-12-19 19:28:17
 

alberto escribió:
hola cena mi msn es :albert_martz@live.com.mx
Fecha: 2009-12-20 00:43:33
 

alberto escribió:
agregame en tu msn
Fecha: 2009-12-20 00:47:10
 

gaston escribió:
hola john eres el mejor luchador del mundo ,vos vas a ser el campeon de la wwe conectate tengo tu mail
Fecha: 2010-01-07 08:45:36
 

brseida cordova ramos escribió:
john cena quisiera cono serte soy fan tuya vivo en ciudad obregon algun dia quisiera que binieras a luchar ara ka
Fecha: 2009-12-21 18:05:56
 

anonimo escribió:
ps yo amo ajohn cena en la noche yo y mi amiga bianca soñamos con el y ella decia mmmm... jjaja eso es todo ok bye....jjaja
Fecha: 2009-12-22 20:52:40
 

pedro olguin escribió:
medas tu coreo cuando vengan de gira a mexicome podrias consegir 3entradas porque siempre eh querido verte luchar tuadmirador pedro
Fecha: 2009-12-30 15:58:05
 

yuridia escribió:
john cena eres el mejor te boy a dar mi correo y me mandas algo es: uvita99_10@live.com,mx bye te cuidas me mandas mensaje.
Fecha: 2009-12-26 10:05:47
 

yuridia escribió:
john cena eres el mejor te boy a dar mi correo y me mandas algo es: uvita99_10@live.com,mx bye te cuidas me mandas mensaje.
Fecha: 2009-12-26 10:06:06
 

sarai escribió:
bueno yo soy nadia eres lo mejor te amo y soy tu fans no. 1 y nadie me podra remplasar bombon y espero q ganes xq yo estoy con tigo
Fecha: 2009-12-26 11:42:24
 

luci escribió:
jhon cena eres el mejor de todos ,tu eres mi ídolo ,te amo . mándame mensajes
Fecha: 2009-12-27 14:15:57
 

SANDRA SANDOVAL escribió:
HOLA ERES LO MEJOR ME GUSTO COMO CARGASTE A BIG SHWO ERES MUY FUERTE LOVE YOU MANDAME TU CORREO CUAL ES ESO ES TODO LOVE YOU LOVE YOU BYE
Fecha: 2009-12-28 12:22:06
 

fatima noemi lopez fernandez escribió:
hola john cena eres el mejor de todos y eres el numero 1 de toda la wwe bueno espero q sigas asi con lo de el bronseador coon sheumus bueno espero q le quietes el campeonato y q tu estes de regreso bueno te cuidas love you eres mi idolo bye
Fecha: 2009-12-29 12:30:10
 

sofia guadalupe valladares navarro... escribió:
john eress lo mejor de lo mejor eres lo maximo del universo ojala y leeAS ESTE COMENTERIO CENA TE QUIERO DECIR Q TU ERES EL *1 DE LA LUCHA LA WWE Y DEL MUNDO RECUERDA Q SOFIA TE AMA TIENES UNA AMIGA + COM MIGO CONECTATE PLIS TENGO 12 AÑOS SOY DE SINALOA
Fecha: 2009-12-29 12:46:30
 

lupita escribió:
rey mysterio.quisiera cono serte soy fan tuya y vivo en barceloneta de quiero conoser rey misterio y de quiero mucho tu amiga lupita sigue asi ganando bay de guidas mucho si
Fecha: 2009-12-31 12:12:40
 

lupita escribió:
rey mysterio.quisiera cono serte soy fan tuya y vivo en barceloneta de quiero conoser rey misterio y de quiero mucho tu amiga lupita sigue asi ganando bay de guidas mucho si
Fecha: 2009-12-31 12:14:20
 

carlos escribió:
jon sena por fa bor da me tu correo porfas yo soi tu acmirador yo te beo sien pre en le tele por fas si te man do muchos saludos
Fecha: 2009-12-29 14:05:40
 

Gianfranco escribió:
HOLA JOHN MI NOMBRE ES GIANFRANCO SOY TU ADMIRADOR,TENGO 10 AÑOS ME GUSTARIA QUE ME INVITES A VER TU ENTRENAMIENTO, QUISIERA APRENDER A LUCHAR COMO TU BYE ESCRIBEME O MANDAME UNA FOTO TUYA SI PUEDES
Fecha: 2009-12-30 13:24:55
 

jarumy dennisse escribió:
soy tu seguidora numero1 me gustaria conocerte en persona yo y mis primas somos tus fans numero one hevisto cuando cargas a big show tengo 10 anos te voy aseguir biendo todos los dias -invitame alas luchas bueno bie t.q.m
Fecha: 2009-12-30 14:09:12
 

iancarlo escribió:
hola soy un gran fanatico tuyo te dejo mi correo porfis agregame de verdad quiero hablar con tigo
Fecha: 2010-01-08 21:10:05
 

esteban escribió:
USTE ES EL MEJOR JUGADOR DE LA WWE QUE CHIBA
Fecha: 2010-01-02 20:18:59
 

iancarlo escribió:
hola soy un gran fanatico tuyo te dejo mi correo porfis agregame de verdad quiero hablar con tigo
Fecha: 2010-01-08 21:10:22
 

ignacio escribió:
john cena aunqe sheymus te gano sigues siendo el mejor de todos ok
Fecha: 2010-01-02 23:56:46
 

ABRAHAM escribió:
JOHN CENA LE VAS A GANAR EL SINTURON A SHEAMUS ESTA NOCHE ADIOS CENA
Fecha: 2010-01-04 14:33:24
 

monserrath escribió:
ola soy la fan numero uno de john cena y qiero desir que lo amo demasiado y es el mejor luchador del mundo te amo john cena MoNsE_n_JoHn_CeNa
Fecha: 2010-01-04 17:35:42
 

miriam lizeth escribió:
hola a mi me encanta todo lo k tenga k ver con john cena mis amigos dicen k soy su mas grande fan y yo digo lo mismo ami me gusta todo de el todo todo lo amo komo a nadie
Fecha: 2010-01-04 19:27:25
 

wadha escribió:
i love john cena es el mejor lo amo y aunque digan que se inyecta no es cierto nadie absolutamente nadie lo superara john cena es el mejor si miren john cena es luchador profecional,cantante de hip hop y actor yo soy su fan numero uno y me gusta todo de el esta guapisimo quisiera poder contactarme con ell!!!! ♥JOHN CENA TE AMO♥
Fecha: 2010-01-04 21:33:00
 

luis tomas escribió:
diganme cual es el correo de john cena envienmelo a mi correo es s_mackdown619@hotmail.com
Fecha: 2010-01-05 12:29:35
 

chano escribió:
cena eres el mejorr luchador dame tu correoi
Fecha: 2010-01-05 14:02:36
 

yubya escribió:
w0laZ amm... z0l0 the kiel0 decyr khe erez el mej0r luchad0r de la WWE nunkha khambiez okyz **~THE AM0 EREZ EL MEJOR~** ¡¡bye!!
Fecha: 2010-01-09 14:37:59
 

yubya escribió:
w0laZ amm... z0l0 the kiel0 decyr khe erez el mej0r luchad0r de la WWE nunkha khambiez okyz **~THE AM0 EREZ EL MEJOR~** ¡¡bye!!
Fecha: 2010-01-09 14:38:45
 

Vianey yasuri escribió:
Ola john cena eres el mejor estas súper guapo Y rebuenote y eres el mejor. randy orton y sus lanmebotas son unos que hacen trampa y derrotalo no dejes que te ganen
Fecha: 2010-01-06 13:17:49
 

DiiaNa escribió:
HoOola JoHn Cena... la verdad eres lo maximo en la wwe! tkm...jeje auq no estes cerca pero siento q te amo... y no haGaz Cazo a los comentarioOs estupiidOoZ..como dicen algunoOs...eso es porq te tienen envidia... esres lo maxiMoOo te AmoO... john cena eres el mejor si Q si jeje... ya mero cumples 33 john.. pero eso no importa jeje asi te amo.. by3
Fecha: 2010-01-06 16:30:29
 

roberto escribió:
me gustaria participar en la WWWE
Fecha: 2010-01-14 17:25:42
 

LUIS escribió:
JONH CENA ES EL MEJOR JUGADOR DE LA WWE Y JEF HARDI
Fecha: 2010-01-12 14:58:16
 

PATY DE CENA escribió:
ESCUCHEN JOHN CENA ES MIO Y NO SE METAN CON EL ES MI ESPOSO TE AMoooo JOHN CENA ERS EL MEJOR MI AMOR Y EL MAQS GUAPO DE TODOS DE LA WWWE PATY Y JOHN CENA
Fecha: 2010-01-15 21:59:52
 

MONIKA YURIKO escribió:
eres lo maximo te admiro mucho me gusta como luchas a parte yo TE AMO TE K.E.M q estes bien adios bye
Fecha: 2010-01-16 14:57:59
 

jordi escribió:
john cena puede tener otro campionato
Fecha: 2010-01-17 19:41:02
 

mel escribió:
mi hermana te adora piensa que eres su papa
Fecha: 2010-01-23 17:56:19
 

taniiii escribió:
john cena eres el mejor de la lucha te amo nunca cambies eres mi novio te amoooooo muchoooooo y me gane la camisa tuya cuando fui a verte y mi hermana la cachucha te amoooo
Fecha: 2010-01-29 21:11:29
 

vanessa escribió:
ola como estan mi novio es jonh cena por k me dio un beso y me dijo k estaba muy bonita y k lo esperara por k ya me conose y yo se quien es y es muy buena onda me compra todo lo k yo le pido por k me quiere mucho y tu no me lo bas a bajar tani el solo me quiere a mi y se donde vive y tu no yo lo conosi en un restauran en A.E.U. Y SOY DE MEXICO pero de vez en cuando me voy para haya y tengo todo lo de el jajajajajajajajajajaj
Fecha: 2010-01-30 12:18:54
 

anthony escribió:
hola.john cena soy tu fanatico y copio tu forma de cer y hago bastant ejercicios para cer como tu e fuert eso de la lucha es verda de los golpe y todo eso mira quisiera chat cntigo para hablar sobre eso de la lucha sip que dices me agregas en tu corre......me llamo anthony y de veras me gusta la lucha libre ya me se barias llaves de lucha
Fecha: 2010-02-02 10:48:26
 

carolina escribió:
te amo john cena eres mi idolo y ninguno de la lucha libre te renplasara eres como nadie
Fecha: 2010-02-04 09:41:57
 

ALE escribió:
A ver primeramente a esa vero y ese tal carlos son un par de amargados.. si no les gusta la lucha entonces como caramba saben nombres y quienes son los luchadores.. de lo q a uno no le interesa no sabe o no???? John Cena es un gran luchador además de ser un papacito es super sexy.... y si tanta envidia le tienen para q coño estan metidos en las páginas donde se habla de el... en fin pa todos una vez mas asi se inyecten esteroides donde quieran.. es un deporte q atrae multitudes no solo por su arte si no por el ingenio de vince q se inventa el drama y las historias q lo hacen cada vez mas interesante a la wwe.. asi q chicos no se amarguen y gocen la vida
Fecha: 2010-02-10 11:03:07
 

rafael escribió:
todos los que los criticais sois unos bocazas lo que pasa es que la envidia es muy mala
Fecha: 2010-02-05 11:58:15
 

griselda escribió:
k john es el mas guapo de todo los hombres
Fecha: 2010-02-05 18:13:34
 

daniel Ignacio escribió:
oyes lepuedes mandar unsaludo a alfredo y triple H es elmejor y randi es una niñita no lo dejen peliar por que va a llorar
Fecha: 2010-02-05 20:46:59
 

belen escribió:
i love jhon cena sabes yo soy tu fans numero 1 eres el mejoer te adoro cuando te veo me muero de felicidad aunque sea de lejos siempre te deseo lo mejor.
Fecha: 2010-02-19 18:48:18
 

flores miranda fernada ofelia escribió:
ho por dios no les hagas caso a esa bola de lucer la unica verdadera fans de ti soy yo sabes espero y bengas promto a tijuana baja california wau seria super fantasticos por cierto esres super geneal el mejor luchador del planeta y yo se que le bas a ganar al cheamus o como se escriba no importa yo se que tu vas a recuperar el campionato de la wwe con amor yooo tu mayor fans del mundo entero yyyyy posdata´ i love you y no importa que estes casado bye kisses
Fecha: 2010-02-18 14:13:09
 

juan escribió:
espero que estes vien de salud. eres un vuen luchador. me fasina como peleas suerte bay
Fecha: 2010-02-20 17:53:04
 

Deysi escribió:
John cena es el mejor luchador del mundo. LO AMO I LOVE YOU
Fecha: 2010-02-18 15:17:44
 

jafet escribió:
mi mama dice que jonh cena es el mas guapo de la raw y que no lo supera nadie
Fecha: 2010-02-21 14:13:49
 

RICARDO escribió:
HOLA JONH CENA ERES EL MEJOR LUCHADOR DE TODO EL MUNDO Y NOTE ENOJES PORQUE batista te QUITO EL TITULO DE LA WWE VETE A ESMAKDOW Y QUITALE EL MUNDIAL PESADO A Cris jericho y lla me voi soy tu fan 1
Fecha: 2010-02-26 16:43:01
 

imelda escribió:
hola bueno yo soy fanatica de john y quisiera su correo por que me muero por tenerlo bueno espero tu respuesta bueno me voy cuidate jhon te quiero mucho ok.
Fecha: 2010-02-24 15:11:43
 

morena escribió:
cena esres el mejor todos lo que te insultan son por que son hombres y les da embidia que seas ta guapo. bueno te quiero mucho cuidate eres el numero 1 como disen mis amigas todos esos insultos seagan bendiciones para tu carrera cuidate te amooooooooo espero algun dia poder chatear con tigo bueno besos bey att morena
Fecha: 2010-02-27 12:34:46
 

pedro escribió:
tu eres el mas grande de los luchadores tu bas aderotar a batista y quiero conoserte en persona por q no tengo los sufisiente dinero para berte q tebaya bin en wretermania adios super estrella
Fecha: 2010-02-27 21:46:02
 

lalo escribió:
oye juon cena pasame tu correo porfas a i te admiro y tu puedes ganarle a batista sayonara chaos
Fecha: 2010-02-28 13:18:05
 

la novia de cena escribió:
cena te amo nos vemos en la noche
Fecha: 2010-03-01 18:59:39
 

cesar escribió:
hola john cena mi amigo dise qe te llamas joto cena pero yo no lo digo por qe soy tu fan numero 1 cuando va a venir la wwe para a ca por qe ya te ciro ver y te voy a echar porras voy a gritar viva john cena
Fecha: 2010-03-06 18:10:09
 

Juan Daniel escribió:
joho cena es un luchador muy chido,me gusta su movimiento llamado s.t.f.¡SI|
Fecha: 2010-03-02 18:33:50
 

dulce maria escribió:
john cena es l mejor de todos los luchadores y lo quier y quiero que me lo cuiden vien porque yo lo quiero y cundo regresa jeff jardi
Fecha: 2010-03-08 18:52:40
 

AARON escribió:
me gusta como peleas con todos y quiero ser como tu
Fecha: 2010-03-13 14:13:18
 

manaurys escribió:
soy tu mejor fan y tengo muchas fotos tullas en mi msn
Fecha: 2010-03-09 15:19:08
 

martha escribió:
john cena ers el mejor me gustas mucho tu,tu cuerpo como luchas siempre t beo soy tu fan nomber wan creeme
Fecha: 2010-03-16 18:38:42
 

nair escribió:
hola amorr mio bueno te keria felisitar x tu boda estabas muy lindo, aunq yo n te voy a jugar por lo q hiziste xq si enrealidad estas enamorad te vas a casar pero... me parece q tu chica es mu poco para vos y creo q fisicamente es mas vieja q vs pero bueno cada uno elige lo q kiere bueno yo te amo muchisimo de verdad te lo digo ya q estas casado ya solo kiero chatiar con vos aunq sea unos minutos por fis bueno ya sabes mi msn te espero ah y soy de argentina y me gusta muchas tus luchas te re kieroooo con todo m corazon..
Fecha: 2010-03-19 15:12:42
 

azucena pimentel escribió:
hola yo soy de estado de oaxaca de santiago chazumba soy tu gran fans porfis dame tu correo please tkm tengo 4 de verte en la t.v solo quisiera chatear contigo siiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii
Fecha: 2010-03-18 20:07:54
 

MARITZA escribió:
JHON CENA CAUTIVASTE UN CORAZON HERIDO SIGUE ASI Y TE IRA MEJOR EN LA VIDA Y GANALE PUES A BATISTA ESE CONSEJO TE LODA UNA PAISANA TUYA DE SANGRE Y CORAZON QUE NO QUIERE VERTE DERROTADO SINO ADELANTE EN TU META DE GANARLE A TODOS LO QUE SE ATRAVIESEN EN TU CAMINO
Fecha: 2010-03-22 17:09:32
 

elvia guadalupe escribió:
hola john cena yo amo de mis sueno eres tu
Fecha: 2010-03-21 18:19:00
 

fernanda escribió:
hola jeohn cena yo seria kapas de raparme la cabellera para conoserte eres el mejor de los mejores te amo muxxo
Fecha: 2010-03-22 19:00:00
 

yaskira escribió:
esta demaciado guapo que lo amo demaciado deciaria que fuera mi novio por esta pura vida te amo mi amor
Fecha: 2010-03-23 12:42:48
 

andrea celeste escribió:
John eres de las pocas personas que pueden surgir a la vida,una persona con las cualidades q tu tienes.soy una de las muchas fans tuyas que REALMENTE QUIERE CONOCERTE,que es uno de mis sueños,y no desfallecere hasta lograrlo porque eres UNICO...y felicitaciones por la pelea en la que le ganaste a batista esa llave STF, eres el mejor sigue adelante una de tus fans que te admira.
Fecha: 2010-04-05 09:56:40
 

nerak escribió:
si john cena es el megor no hay otro como john yo soy tu fans numero 1 y me da mucho gusto q ya tengas tu sinturon por q tu puedes benser a todo el q se te cruse en tu camino y yo estoy muy lokita por ti me encantas nunca me piedo nada de ti todas tus luchas las e visto por fa dime tu correo o tu numero de cel espero tu respuesta adios te amo♥♥♥
Fecha: 2010-04-01 23:59:50
 

ronny zumba escribió:
jhon cena es tremendo luchador yo soy ronny de ecuador por favor que alguien me envie el correo de jhon cena y estoy seguro de que jhon va a derrotar a batista y sera nuevamente el campeon de la wwe
Fecha: 2010-03-28 16:36:10
 

martha maria avalos hinojosa escribió:
hola john cena es lo mejor de todos por igual rey misterio y evan los quiero bay y besos a ellos
Fecha: 2010-04-03 14:24:04
 

jOSS escribió:
jonh cena por que te hacn eso
Fecha: 2010-04-05 23:53:32
 

paco escribió:
john cena es el mejor,mas k triple h,undertaker y otros,es el mejor y toda su ropa,sus movimientos de lucha y sus canciones son las mejores,soy tu mas grande fanatico
Fecha: 2010-04-09 19:50:51
 

sarai escribió:
bueno todos lo k piencen k john cena no sirve se ekibocan xk el es mejor de todos los tiempos yo soy su fan (: john cena eres el mejor nunca kambies....
Fecha: 2010-04-06 20:29:55
 

john cena escribió:
hola les digo algo no existe persona mas fanática que yo en la wwe que yo y a ti john cena no se te olvide que un dia voy a ir a verte y ganarle al batista mejor concido como batiguey pero si algun dia te veo no se te olvide soy tu mejor fanatico en el mundo entero (eres el mejor campeón de la wwe)
Fecha: 2010-04-07 12:53:39
 

carlos escribió:
JHON CENA CUANTOS AÑOS TIENES JHON CENA
Fecha: 2010-04-08 12:25:01
 

ivan escribió:
eres el mejor de todos john cena quisiera tener tu correo para chatear con tigo
Fecha: 2010-04-16 16:21:16
 

IVAN ALFREDO escribió:
HOLA JONH CENA SOY UN NIÑO DE 7 AÑOS Y SOY TU FANS NUMERO UNO, NO ME PIERDO LAS LUCHAS ME GUSTARIA QUE ME ESCRIBIERAS AL CORREO DE MI PAPÁ, TODOS MIS COMPAÑERITOS DE LA ESCUELA HABLAN DE TI TAMBIEN SON FANATICOS COMO YO, Y YO TENGO TODOS LOS BRASALETES TUYOS Y TAMBIEN TENGO PLAYERAS CON TU FOTO. YOU CANSIMY.
Fecha: 2010-04-16 22:45:14
 

PATY DE CENA escribió:
la neta john cena estas bien guapo eres el mejor de la wwe por eso seres el cambio bueno la neta ke bueno ke le ganastes al batista eres supero jhn cena la verdad eres mi novio me gustas muxxo cuidate bye te amo eres el mejor algun dia te ire aver luchar por ke se ke tu simpre vas a ganas ke nadien te pude ganar ati eres el mejor te amo cuidate bye aki estoy para todo y solo para ti mi campion de la wwe bye te kiero muxxo ♥♥♥:D
Fecha: 2010-04-18 01:10:49
 

victor manuel escribió:
john cena eres el mejor del wwe y espero que le ganes al gay de batista en extreme rules y a todos los luchadores le decimos esto you can"t see me
Fecha: 2010-04-19 12:47:08
 

lady escribió:
ola jhon cena sabes soy tu fans nª1 eres el mejor de la wwe a tbm rey misterio eres super guapo y no le hagas caso a los comentarios malos que te escriben adios no olvides que te amo,te amo,te amo y 100pre lo voy hacer ah por cierto dale duro al bobo de batista en extreme rules 2010
Fecha: 2010-04-21 19:29:30
 

enrriqueta escribió:
no me puedo quejar john cema esta hecho un cuero ade mas qui dise de donde sacaron tanto muñeco
Fecha: 2010-04-22 15:07:17
 

itzel viviana cruz corrales escribió:
hola yo pienso que john cena es el mejor luchador hasta digo que es mi padre y no me lo pierdo cada lunes y mickie james es una de mis favoritas aunque hay muchas pero ella es una de muchas ♥♥♥ bueno me voy bye
Fecha: 2010-05-01 00:27:59
 

mary escribió:
john cena es el mejor y quiero conocerlo x q quiero q sea mi novio.
Fecha: 2010-04-28 19:42:50
 

jefferson escribió:
HOLA CENA SOY FAN NUMBER 1 ERS EL MEJOR BATISTA QUEDA PEQUEÑO A LADO TUYO SIGUELO VENCIENDO Y BUENA IDEA AMARRARLO EN PELEA DEL RULES EXTREMA BYE TE VOY AL 100
Fecha: 2010-04-29 21:53:13
 

Mario escribió:
quiero tu email cena porfavor te lo pido para chatear
Fecha: 2010-05-04 21:32:03
 

CARLOS ALBERTO escribió:
qui ero que randi gane
Fecha: 2010-05-04 22:01:49
 

ROCIO GUZMAN REYES escribió:
JONH CENA ERES EL MEJOR LASTIMA K ESTAS CASADO SOY TU FAN NUMERO UNO SI ME PIDIERAS K ME CASE CONTIGO NO LO PIENSO DOS VECES
Fecha: 2010-05-06 19:43:24
 

GAB!!! ESC5RIBIO: escribió:
HOLA!!! JOHN CENA YO SOY TU SEGUIDORA DESDE HACE MUXO, TU ERES EL MEJOR LUCHADOR DE LA WWE Y DE TODO EL MUNDO ZzABE UNA COSA YO TE ADMIRO MUCHIXIMO T.Q.M. AD!!!OS...
Fecha: 2010-05-07 13:17:35
 

GAB!!! ESC5RIBIO: escribió:
HOLA!!! JOHN CENA YO SOY TU SEGUIDORA DESDE HACE MUXO, TU ERES EL MEJOR LUCHADOR DE LA WWE Y DE TODO EL MUNDO ZzABE UNA COSA YO TE ADMIRO MUCHIXIMO T.Q.M. AD!!!OS...
Fecha: 2010-05-07 13:18:18
 

jorge luis escribió:
ers el maximo luchador y el mas fuerte del mundo asi que tendras que prepararte cuando te enfrentes a undetaker o kane
Fecha: 2010-05-08 16:38:54
 

LUIS ENRIQUE BAEZ escribió:
hola john cena mencanta como luchas tueres el numero 1 tu eres increible pocuando cargastes big show y a edge olle mepuedes mandar tu correo
Fecha: 2010-05-08 18:02:52
 

soldado profeta colombiano escribió:
jhon todo el grupo especial te admiramos porque eres el unico que te acuerdas de los militares asi sea solo los de eeuu nos gustaria que un dia nos visitaras a nosotros los del grupo especial aunque solo la pasamos de combate en combate nos gustaria escuchar algun dia que les hiciste un homenaje a los soldados heridos en combate ojala gracias
Fecha: 2010-05-20 12:15:35
 

CLARA JAZMIN escribió:
ERES EL MAS GUAPODE TODOS LOS LUCHADORES Q AY EN EL MUNDO OK
Fecha: 2010-06-16 19:47:51
 

Yamile Heredia escribió:
JOHN CENA TE ERES EL MEJOR DE LA WWE TU LE GANARAS A TODOS YO SOY TU FANS #1 SE TODO DE TI ILOVEYOU
Fecha: 2010-07-01 13:59:07
 

jessi escribió:
solo te escribo para decirte k eres el luchador mas guapo y mas fuerte de la wwwa ok te amo eres el mejor nunca me pierdo las luchas y menos cuando estas tu a toda mi familia le gusta ver como peleas y no te das xvencido tu puedes cina bezoz
Fecha: 2010-06-17 14:17:39
 

luisalberto escribió:
pasame tu correo y el de kelly kelly
Fecha: 2010-05-26 14:27:31
 

KING escribió:
john cena eres el mejor me encanta ver tus luchas y cuando te hacen trampa me pongo triste soy de nicaragua y qui siera saber tu correo porfa ers el mejor de la tv
Fecha: 2010-05-29 20:16:44
 

HANA KENIA escribió:
HOLA JHON CENA I LOVE Y NESESITO TU CORREO LO ESPERO JEJE
Fecha: 2010-06-14 17:34:32
 

analucia escribió:
JHONCENA ES LO MEJOR JHON CUANDO VEAS ESTO TECAERAS MUERTO KIERES SER MI ESPOSO? YO TE AMO Y NO ACEPTO UN NO COMO RESPUESTA TE KIERO TE ADORO NO PIENSO SI NO ES EN TI TODO EL DIA EN EL EVENTO DAME UNA RESPUESTA PILSSSS !TE AMO!
Fecha: 2010-06-02 15:30:25
 

DANYELA escribió:
ola cena te quiero y pasa x mi metro ok es www.metroflog.com/dannydivix adios bayito y te quiero soy tu admiradora numero1
Fecha: 2010-06-08 17:22:06
 

carlos andrey escribió:
cuales el msnde john cena
Fecha: 2010-06-15 16:32:17
 

JOSE ANTONIO escribió:
ERES EL MEJOR CENA SOY TU ADMIRADOR NUMERO1111111111111111
Fecha: 2010-06-09 16:55:44
 

daniel escribió:
john cena eres el mejor espero k 100 pre estes en la wwe
Fecha: 2010-06-12 12:30:32
 

ALIOZ escribió:
ERES EL LUCHADOR MAS GRANDIOSA Y FANTASTICO SIEMPRE ESTAS EN MI MENTE ERES LO MAXIMO. ME GUSTARIA QUE VINIERAS A TAMPICO PARA PÓDER VERTE EN PERSONA Y PODER QUITARME ESA SENSACION QUE TENGO A SIA TI. ME EXITAS CADA VEZ QUE TE VEO EL LA TELE EN TU FORMA DE PELEAR ERES EL MEJOR.
Fecha: 2010-06-16 13:04:12
 

Aaron escribió:
que tranza john cena
Fecha: 2010-05-28 19:20:11
 

juan francisco ortiz nava escribió:
john cena eres el rostro de la wwe y yo soy tu mas grande fan
Fecha: 2010-06-23 23:19:37
 

erik efren escribió:
eres e mejor nadie te gana
Fecha: 2010-06-20 17:10:40
 

chito escribió:
john cena tu eres el NUMERO UNO DE LA WWE MADI TE GANARA Y YO SOY TU FAN NUMERO UNO
Fecha: 2010-06-24 10:40:16
 

rodolfo escribió:
john cena es el mejor luchador del mundo megusto cuando se enfrnto contra nxt
Fecha: 2010-07-07 20:22:11
 

miguel escribió:
hi soy de chile y soy uno de los fanes de la wwe y en especial JHON CENA.como diria hugito savinovij cosa ma grande jhon y no lo olviden THE CHAMP ITS HERE¡
Fecha: 2010-08-18 14:45:17
 

maria fernanda escribió:
holaz soy fanatica de jhn cena y muchos mas te amo siempre voto por ti si pelea jhn cena vs jhn merrison voto por los dos o si no por jhn cena TE ADORO Y AMO
Fecha: 2010-07-08 19:01:26
 

Absa escribió:
Hola oigan me pueden mandar el correo de john cena x fa mi correo es absa.95@hotmail.com agregame y yo te paso el de maribel guardia
Fecha: 2010-07-16 13:30:50
 

Gonzalo escribió:
cena,eres lo mejor de la wwe,llevo siguiendo tus luchas desde los 3 años y eres mi ídolo siempre e querido ser como tu porque (como dice tu lema)eres:honesto,tienes lealtad y también respeto por todos/as luchadores/as de la wwe espero que esto llegues a leerlo y tengo unas ganas impresionantes de ser como tu de mayor:tan bueno,generoso,atlético y tanto generoso como honesto,espero llegar a ser un gran luchador como tu pronto y además tengo el presentimiento de que algún día nos veremos. TU MAYOR ADMIRADOR GONZALO.GALLEGO
Fecha: 2010-07-13 15:54:23
 

Yenni, alias ( MINITOY) escribió:
ola JOHN CENA. sabes me gustas muchothe... eres el mejor en la wwe. me encanta tu forma de ser spero k algun dia te pueda conocer de frente ese es mi mayor sueño, aparte de ser militar claro. si DIOS kiere cuando ste mas grande y tenga dinero claro me voy un tiempo a estados unidos para poderte conocer. te amo muchisimo. nene lindo. no me importa k ya estes casado,si tan solo te ejaras venir tantito... estoy algo loca pero ti.bueno adios TE AMO...:]
Fecha: 2010-07-14 16:35:17
 

brenda escribió:
john cena es el mejor es el numero1 de todos es mejor que randi orton y es el mas guapo de todos los hombres
Fecha: 2010-07-19 21:12:26
 

evencio flores hernandez escribió:
MIRA JOHN SOY TU FIEL ADMIRADOR TUYO PERO COMO SOY UN OBRERO NO PUEDO IR A CONOCERTE NI CUANDO VIENES A PUEBLA QUIERO QUE SEPAS QUE CARLOS Y LA TAL VERO NO SABEN LO QUE DICEN YTODOS LOS QUEESTAS LLENO DE ESTEROIDESYO SE QUE NO POR QUE CUANDO UNO HACE EJERCICIO LUEGOLUEGO SE VE QUIERO TENER ALGO TUYO PERO COMO GANO MUY POCO NO ME ALCANSA MIRA CASI SIEMPRE ME PONGO MI VERMUDASTE MANDO MUCHOS SALUDOS Y UN GRAN ABRAZO NUNCA CAMBIES
Fecha: 2010-07-17 10:24:42
 

erika escribió:
jonh ere el mejor y eres muy guapo felicidades por todo lo k has logrado y k lleges mas lejos y logres tu sueños te amo soy tu fan numero 1. que dios te bendiga
Fecha: 2010-07-23 22:46:41
 

kevin escribió:
JOHN CENA ERES EL MEJOR LUCHADOR DE LA WWE DE LA HISTORIA
Fecha: 2010-07-31 09:14:36
 

MARIA ELENA escribió:
te amo cina eres el mas guapo de la wwwe me gusta berte pelear hojala te conociera love you chiquito
Fecha: 2010-08-01 18:37:23
 

maria elena escribió:
hola jonh cena hojala me pasaras tu correo y te pudiera conocer yo soy tu fams nimer 1* eres elmas guapo dela wwe eres mi chiquibeyby aonque no te pueda conocer te quiero mucho tkm chiquito bombom de cina
Fecha: 2010-08-01 19:33:43
 

felipe plata escribió:
eres lo maximo y eres un verdadero amigo espero que algun dia te pueda conocer y sigue defendiendo lo justo eres un justiciero me llamo felipe tu mejor amigo si es que lo soy
Fecha: 2010-08-05 17:53:35
 

dj logico escribió:
hola fanaticos del mundo wwe les abla logico el luchador nobato de la wwe yo soy el alumno de john cena si enberdad quieren comunicarse con jhon cena entren a mi correo y si me combensen sus ofertas yo les doy el correo de john cena el verdadero o de cualquier luchado o luchadora de la wwe este es mi correo dj_logico@hotmail.com
Fecha: 2010-08-06 23:11:22
 

DuvaLina D' Cena escribió:
aww...*amoo a ese Hombree es lo mejor de la wwe sii sii! :) (Y)
Fecha: 2010-08-11 14:45:17
 

estrella escribió:
jon cena eres mi fals n u m e r o 1
Fecha: 2010-08-11 21:19:09
 

luisa fernanda escribió:
eres lo mejor eres mi idolo te quiero mucho sigue asi y yo odio mas NEX
Fecha: 2010-08-19 21:12:13
 

Dani De Cena escribió:
oooo mi cena eres el mejor la verdad todos los ke te dicen mamadas es porque te tienen envidia yo pienso y veo que eres el mejor de todo el word si k si the amo mi ckoszo moxo szi k szi mee enckantha thyu leenda mirada tu sonrisa i todo thu eres eel mejor the mewa amo
Fecha: 2010-08-23 22:43:39
 

cecilio escribió:
john cena eres el mejor de la wwe
Fecha: 2010-08-29 17:46:21
 

ale escribió:
ola pzz solo kiero k me manden el correo de john cena lo kiero contactar soy su fan numero 1 y me vuelvo loca cada ves que lo veo pelear me encantaria que viniera a veracruz me gustaria conocerlo en persona lo amo y li kiero mucho mandenme su correo su metroflog y su twiter o facebook pero mandenmelo le mando besos a john cane bye lo AMO
Fecha: 2010-10-09 00:57:15
 

deyvi escribió:
cena soy tu admirante favorito mucha suerta te quiero mucho bayyyy
Fecha: 2010-09-04 22:49:51
 

kevin escribió:
eres el mejor quiero que te salgas de los nenxus
Fecha: 2010-10-08 00:11:00
 

monse de cena escribió:
ha y quien quiera hablar de john cena aqui esta mi msn monsecena33_200@hotmail.com si john cena ve esto tambien quisiera saber demasiadas cosas de le . posdata:te kiero y jamas te dejare de apoyar
Fecha: 2010-10-09 19:11:16
 

cesar escribió:
john cena chale k te sacaron de la wwe pero k importa almenos ya no te segiranpegando bye mi hermano te manda besitos
Fecha: 2010-10-10 21:22:57
 

iveth escribió:
john cena es tan sexy y lindo lo amo soy una gran fan de el besos y abrazos a john cena TE AMO
Fecha: 2010-10-05 10:30:44
 

maria jose escribió:
john cena eres el mejor de todo el mundo y universo te amo porfa agregame para chatear con tigo te amo y eres mio y de nadie mas a y no presto a mi proximo novio
Fecha: 2010-10-10 17:16:13
 

elizabeth escribió:
mm eres el mejor y la verdd me encanta tu forma de ser siempre sosteniendo lo qe dises eso vale mucho eres de gran corazon un grandisimo ser hu mano y aparte lindo T.K.M
Fecha: 2010-10-07 11:31:10
 

dulce cortes acosta escribió:
cena siempre sera jonh cena este con kien este claro k hay siempre gente gandalla k se va aprobechar de el por k es el mejor el junto con HHH hacen lo k es es espectaculo de raw aunk ahora se encuentra debilitado pork falta la presensia de hhh pero cena siempre va a ser el idolo de todas las chavas y chavos cena,cena,cena,cena....
Fecha: 2010-10-21 10:43:49
 

ROXXI escribió:
estas muy guapo eres un muy buen luchador aunque espero que te valla muy chido y que nunca pase a mayores tus golpes te quiero
Fecha: 2010-10-25 21:24:24
 

leo escribió:
el mejor luchador del mundo
Fecha: 2010-11-01 18:19:30
 

leonel escribió:
hola john cena soy fan nº1 eres mi luchador favorito quiero tu correo para que me agreges esto es mi correo: leo_tugente@hotmail.com por favor agregame para que me envies tu correo por favor quiero hablar contigo he visto todas tus peliculas como: el legendario, donde tu actuas de ser su hermano de calvin chettlin para que le enseñes a luchar. bueno ya me canse de escribir por favor mandame tu correo ojala que me envies. xD. ;D
Fecha: 2010-11-03 22:32:28
 

MAURICIO escribió:
SOS EL MEJOR JOHN CENAAAA NADIE TE GANAAA SOS UN CAPO TE AGUANTAS CON CUALQIERA NADIE TE SUPERA SOS UNOS DE LOS MAS PIOLAAAS QUISIERA SER COMO VOS CUANDO SEA GRANDEEE
Fecha: 2010-12-17 11:52:07
 

zaida escribió:
JOHN CENA eres el mejor de la wwwe y de todo el mundo TE AMO y me gustaria conocerte eres el MEJOR LUCHADOR y ademas de eso estas BIEN PAPACITO!!!
Fecha: 2010-12-27 16:45:15
 

zaida escribió:
JOHN CENA eres el mejor de la wwwe y de todo el mundo TE AMO y me gustaria conocerte eres el MEJOR LUCHADOR y ademas de eso estas BIEN PAPACITO!!!
Fecha: 2010-12-27 16:46:42
 

paola escribió:
john cena es el mejor luchador de todo el mundo y espero casame con tigo te amo con todo mi corazon
Fecha: 2011-01-16 11:09:44
 

josemi escribió:
olaaaaaaaaaaaaaaaaaaaaaa
Fecha: 2011-01-26 15:12:04
 

PIERO CUADROS NUÑEZ escribió:
Yhon Cina, quien te habla es tu admirador, soy de Perù, tengo 11 años. El motivo es para decirte que te admiro mucho, acabo de ver tù ultima pelea el 30 de Enero del 2011 de ROYAL RUMBLE, pues amigo te hicieron trampa, bueno de aqui te apoyamos mi hermano Giordy y yo; lucha con ética y valores como siempre lo haces por eso te admiro Jhon Cena, no dejes nunca el deporte y sigue adelante, te admiramossssssssss. tu amigo por siempre Piero de Oris. Nota.- Haber si me escribes a mi correo, amigo seria bueno saber de ti.
Fecha: 2011-02-03 18:31:41
 

Eli escribió:
A todos los que le gusta JOHN CENA AGREGENME ELI-T207@HOTMAIL.COM PORFAVOR AGREGENME QUISIERA TENER AMISTADES CON PERSONAS QUE LES GUSTA LA WWE
Fecha: 2011-01-01 04:40:25
 

guadalupe francisco de los santos escribió:
john eres el mas guapo de todos los de la wwe y atodas las personas k les gusta john agregenme pliiiiiisssssssssss t amo john cuidate
Fecha: 2011-01-06 19:34:05
 

ALFRED escribió:
John eres en verdad el mejor luchador de todos peleas muy bien porque siempre sales ganando como lo hiciste con randy,batista, los nexus,etc.ERES EL MEJORRRRRRRRRRRR...
Fecha: 2011-01-09 04:55:49
 

juan alberto escribió:
hola john me gusta mucho como peleas eres mi favorito de veral nunca dejo de ver las pereas porq cuando no te veo me porjo muy aguitado
Fecha: 2011-02-18 00:32:00
 

JENNIFER escribió:
hola,jhon soy de costa rica,eres mi idolo, soy tu fan #1, eres el luchador mas guapo de la wwe, te admiro demasiado por como eres ,tienes una sonrisa preciosa eres demasiado "HOT", tengo tus peliculas ahora que viniste a costa rica no pude ir porque no tenia entrada, pero una amiguis mia me dijo que estuvo super, espero que vuelvas algun dia a nuestro pais, porque tienes muchas admiradoras incluyendome en esa lista,por favor quiero tu correo, haber si me quieres agregar como amiga tuya,este es el mio: jenni52511@hotmail.com, espero saber de ti pronto,chao cuidate muuuuuuuuuucho,besos
Fecha: 2011-03-01 11:04:16
 

SIMEON escribió:
Digan lo q digan los mallulleros John Cena es lo mejor den la empresa WWE y le pateara el trasero a la Rocka como tambien le dara una leccion al The Mis.
Fecha: 2011-03-01 23:50:37
 

ARTU escribió:
ERES EL MEJOR DE LA WWE JOHN CENA
Fecha: 2011-03-09 23:37:44
 

sara escribió:
john cena eres lo mass I LOVE YOU JOHN CENA! Soy tu fan Numero 1 eres el mejor de toda la wwe ,eres el mejor luchador del mundo mundial otra cosa dile a santino marela q le odio mucho .Pero a ti te quiero muuuuuuuchooooo!!
Fecha: 2011-04-26 15:01:43
 

Henry escribió:
jhoncina eres lo maximo le arevataste el campeonato de la wwe a el miz que es un mentirozo
Fecha: 2011-05-12 01:33:33
 

jhon deyvi escribió:
john cena soy un fan tuyo te admiro mucho
Fecha: 2011-05-19 12:50:22
 

Mayra escribió:
john cena te amo eres el mejor luchador del mundo desde que te vi me gustaste no me pirdo tus luchas colecciono todo lo que tega tu imagen te amo te admiro tanto que hasta me tatue tu nombre te amo nuca cambies eres el mejor I LOVE FOREVER
Fecha: 2011-05-26 22:02:00
 

jewow escribió:
esta gente si que es envidiosa como john esta super bueno y es lo mas bello que hay lo critican pero que se le hace la envidia no mata pero mortifica para los envidiososss!!!!cena es el mejorr!!!!
Fecha: 2011-06-30 12:29:05
 

jhon fernandez cotrina escribió:
olas amixo jhon cena me llamo jhon espero cuando salgas al rin a peliar saludaras a todos los peruanos y apaso saludame ami me llamo jhon y erika erika es mi enamorada chau cuidate john
Fecha: 2011-07-14 14:57:20
 

javier escribió:
eres lo maximo jhon asles saber quien es el jefeeeeeee
Fecha: 2011-06-22 11:55:11
 

roxx escribió:
te amo ers mi luchador favorito pateale el trasero a todos los luchadores y manda a todos al hospital para que sepan quien es al jefe.......................
Fecha: 2011-08-02 17:05:36
 

claudia's cena escribió:
todos pueden decir ke son "fan" de John Cena... y lo acepto, pero no creo que haya alguien que me pueda superar... ok? y es la vdd porque NADIE es mas fanatica de John que muaa... lamento decirselos chicas pero ese hombre es solo mio
Fecha: 2012-04-02 22:50:24
 

jose escribió:
hola john cena yo tengo toda mipiesa de ti
Fecha: 2011-10-04 12:15:11
 

AnGus MacGyver Anthony Cena escribió:
Hola a todos: Para los que no sabian les tengo un noticion; yo soy el unico y biologico hijo del luchador, actor, luchador profesional y ex fisicoculturista John Cena yo naci producto de su relacion con Elizabeth pero eso es historia pasada y el no lo sabe por fa quien me puede hacer el favor de comunicarle que actualmente estoy viviendo en Costa Rica pero que no pierdo la esperanza de reunirme en familia con el; aquel que le comunique sera recompensado por mi propia persona y mi representante me reservo el nombre solo les adelanto que es mi mejor amigo, escuchen tambien quiero agradecerles a todos los que han dicho comentarios sobre mi padre de verdad gente muchas gracias a todos y estoy seguro que algun dia le dare el mensaje por ustedes si llego a encontrarme con el pero quien me promete ayudarme a encontrarlo, a todos aquellos que odian a Cena ya maduren es mejor que ustedes pelafustanes. Yo al igual que el soy actor, luchador profesional, rapero, cantautor de baladas pop también y también músculos y los ojos azules como el, pero estoy soltero pero no a la orden; mis mejores amigas las modelos costarricenses Melissa Mora y Kimberly Chaves estan enamoradas de mi las dos al mismo tiempo y la verdad ya no se que hacer, que me recomiendan? que hable con las dos o que?. Los unicos que saben mi secreto son mis amigos y la empresa para la cual trabajo aqui en Costa Rica, Repretel en los tres canales que tiene 4, 6, y 11; pero el trabajo me lo reservo sin dar mucho detalle no hablare de eso. Es extraño que John nunca lo haya sabido porque la misma Elizabeth se lo dijo, John esto no es justo para el niño y bueno el no la quiso escuchar creo que ahi se genero el problema. Ayudenme por favor. Les explicare mi madre me bautizo bajo el nombre de AnGus MacGyver Anthony Cena y bueno Cena nunca lo supo y hasta la actualidad no se da cuenta de que tiene un hijo no sabe de la existencia de este, y eso me preocupa porque realmente no se si pueda seguir tolerando pasar mas tiempo lejos de el, se a que se refieren cuando dicen que es el mejor en el mundo, gracias de verdad, aunque yo prefiero no dar mucho detalle sobre el asunto. Si me gustaria que supieran que amo a mi padre tanto como ustedes, lo admiro y soy su fanatico no numero 1 ustedes ya me robaron ese privilegio felicidades pero si me dicen en la calle cuando me ven pasar y me reconocen: aOye niño en serio eres hijo de John Cena? Y yo: Si señor o señora si es mujer en este caso aunque no lo sepa yo estoy aqui ganandome un salario para ahorrar para ir a Massachussets pronto y estar con el de paso me piden autografos y fotos y yo con gusto acepto; en cuanto a diferencia en rap entre mi padre y yo hay una gran diferencia; el es el mejor rapero del mundo y el mejor que existe segun Kim y Meli mis amigas gracias chicas pero yo si hago conciertos de rap el no y yo tengo varios discos ingles y español y variado y el solo uno You Can´t See Me y bueno eso nos hace un poco diferentes. Pero en cuanto a fisico somos iguales, el musculoso yo tambien, el ojos azules yo tambien, el actro, luchador, ex fisicoculturista y rapero yo tambor. Entonces creo que no hay mucha diferencia, pero ya hablando con toda la palabra VERDAD les digo y les cuento que aqui en Costa Rica en los canales de este pais y en el pais en total se ha generado polemica porque han dicho que es increible que tengan al hijo de John Cena aqui y que el no lo sepa no sepa de mi existencia no sepa que tiene un hijo y que estoy aqui esperando por verlo a que venga aqui a Costa Rica y como pueden ver mi problema no es el español eso lo hablo a las mil maravillas no es que presuma pero ya lo pueden ver y tambien hablo ingles pero en mi trabajo casi no uso el ingles y por ende el español solo lo entiendo cuando veo programas de tv en ingles sin subtitulos y bueno lo traduzco en mi mente. Pero lo que quisiera es que me ayudaran a encontrarme con el, por fa; no les he dicho mi edad tengo 17 naci en 1995 pero en ese tiempo John tenia 20 es posible que no se acuerde ya que yo vivi con el en Massachussets hasta el 2009 que en ese año me vine para aca y bueno ya sabia español lo aprendi por medio del Internet mientras estaba en Massachussets tengo 03 años en CR ya voy para 4 este 2013 y eso es lo que me duele pasar tiempo sin el en especial Navidad y Año Nuevo seria mi tercer año que lo recibo sin el aunque tengo el apoyo de mis compañeros de canal, empresa y amigos sobre todo Kimberly Chaves y Melissa Mora que son como mis hermanas mis mejores amigas, Kimberly 26 años y Melissa 25, dos de las modelos mas cotizadas del pais, no es para menos con esos hilos y escote y todo bueno, ya basta de ellas las veo hasta en mi cuarto tengo un poster de las dos en mi pared del cuarto sin contar el de Cena pa recordarlo. Ayudenme!
Fecha: 2012-11-25 23:36:51
 

AnGus MacGyver Anthony Cena escribió:
Hola a todos: Para los que no sabian les tengo un noticion; yo soy el unico y biologico hijo del luchador, actor, luchador profesional y ex fisicoculturista John Cena yo naci producto de su relacion con Elizabeth pero eso es historia pasada y el no lo sabe por fa quien me puede hacer el favor de comunicarle que actualmente estoy viviendo en Costa Rica pero que no pierdo la esperanza de reunirme en familia con el; aquel que le comunique sera recompensado por mi propia persona y mi representante me reservo el nombre solo les adelanto que es mi mejor amigo, escuchen tambien quiero agradecerles a todos los que han dicho comentarios sobre mi padre de verdad gente muchas gracias a todos y estoy seguro que algun dia le dare el mensaje por ustedes si llego a encontrarme con el pero quien me promete ayudarme a encontrarlo, a todos aquellos que odian a Cena ya maduren es mejor que ustedes pelafustanes. Yo al igual que el soy actor, luchador profesional, rapero, cantautor de baladas pop también y también músculos y los ojos azules como el, pero estoy soltero pero no a la orden; mis mejores amigas las modelos costarricenses Melissa Mora y Kimberly Chaves estan enamoradas de mi las dos al mismo tiempo y la verdad ya no se que hacer, que me recomiendan? que hable con las dos o que?. Los unicos que saben mi secreto son mis amigos y la empresa para la cual trabajo aqui en Costa Rica, Repretel en los tres canales que tiene 4, 6, y 11; pero el trabajo me lo reservo sin dar mucho detalle no hablare de eso. Es extraño que John nunca lo haya sabido porque la misma Elizabeth se lo dijo, John esto no es justo para el niño y bueno el no la quiso escuchar creo que ahi se genero el problema. Ayudenme por favor. Les explicare mi madre me bautizo bajo el nombre de AnGus MacGyver Anthony Cena y bueno Cena nunca lo supo y hasta la actualidad no se da cuenta de que tiene un hijo no sabe de la existencia de este, y eso me preocupa porque realmente no se si pueda seguir tolerando pasar mas tiempo lejos de el, se a que se refieren cuando dicen que es el mejor en el mundo, gracias de verdad, aunque yo prefiero no dar mucho detalle sobre el asunto. Si me gustaria que supieran que amo a mi padre tanto como ustedes, lo admiro y soy su fanatico no numero 1 ustedes ya me robaron ese privilegio felicidades pero si me dicen en la calle cuando me ven pasar y me reconocen: aOye niño en serio eres hijo de John Cena? Y yo: Si señor o señora si es mujer en este caso aunque no lo sepa yo estoy aqui ganandome un salario para ahorrar para ir a Massachussets pronto y estar con el de paso me piden autografos y fotos y yo con gusto acepto; en cuanto a diferencia en rap entre mi padre y yo hay una gran diferencia; el es el mejor rapero del mundo y el mejor que existe segun Kim y Meli mis amigas gracias chicas pero yo si hago conciertos de rap el no y yo tengo varios discos ingles y español y variado y el solo uno You Can´t See Me y bueno eso nos hace un poco diferentes. Pero en cuanto a fisico somos iguales, el musculoso yo tambien, el ojos azules yo tambien, el actro, luchador, ex fisicoculturista y rapero yo tambor. Entonces creo que no hay mucha diferencia, pero ya hablando con toda la palabra VERDAD les digo y les cuento que aqui en Costa Rica en los canales de este pais y en el pais en total se ha generado polemica porque han dicho que es increible que tengan al hijo de John Cena aqui y que el no lo sepa no sepa de mi existencia no sepa que tiene un hijo y que estoy aqui esperando por verlo a que venga aqui a Costa Rica y como pueden ver mi problema no es el español eso lo hablo a las mil maravillas no es que presuma pero ya lo pueden ver y tambien hablo ingles pero en mi trabajo casi no uso el ingles y por ende el español solo lo entiendo cuando veo programas de tv en ingles sin subtitulos y bueno lo traduzco en mi mente. Pero lo que quisiera es que me ayudaran a encontrarme con el, por fa; no les he dicho mi edad tengo 17 naci en 1995 pero en ese tiempo John tenia 20 es posible que no se acuerde ya que yo vivi con el en Massachussets hasta el 2009 que en ese año me vine para aca y bueno ya sabia español lo aprendi por medio del Internet mientras estaba en Massachussets tengo 03 años en CR ya voy para 4 este 2013 y eso es lo que me duele pasar tiempo sin el en especial Navidad y Año Nuevo seria mi tercer año que lo recibo sin el aunque tengo el apoyo de mis compañeros de canal, empresa y amigos sobre todo Kimberly Chaves y Melissa Mora que son como mis hermanas mis mejores amigas, Kimberly 26 años y Melissa 25, dos de las modelos mas cotizadas del pais, no es para menos con esos hilos y escote y todo bueno, ya basta de ellas las veo hasta en mi cuarto tengo un poster de las dos en mi pared del cuarto sin contar el de Cena pa recordarlo. Ayudenme!
Fecha: 2012-11-25 23:36:35
 

rosa escribió:
hola jonn eres lo mejor sepr genial no m pierdo tus peleas bay cuidate sige siendo como eres
Fecha: 2012-07-18 18:40:50
 

brandon escribió:
jhon cina soy un peruano y mi sueños siempre a sido ser tu disipulo
Fecha: 2012-07-30 13:35:56
 
Agregar un Comentario
 
Tu Nombre :
Tu Email :
Comentario :
 

MegaSitio.org utiliza para su publicación TosuPress un producto desarrollado por Avisil