MegaSitio Artículos de Interés MegaSitio Autos MegaSitio Belleza MegaSitio Dietas MegaSitio Recetas MegaSitio Mujer MegaSitio Entretenimientos
Noticias en MegaSitio
Videos en MegaSitio
Enlaces Sugeridos
Temas de Interés

Juega con los personajes de High School Musical 2

Publicada en : 2007-07-21 en la categoria: Juegos

La web del canal infantil tendrá durante 6 semanas varios juegos de High School Musical 2, al finalizar este periodo habrá un maratón en la web con multitud de premios.

Del 23 de julio al 2 de septiembre tendrá disponibles juegos protagonizados por los personajes de la Película Original de Disney Channel High School Musical 2.

Cada semana se estrenará un nuevo juego, que estará disponible hasta que acabe el maratón. Cada juego está protagonizado por un personaje.

Los niños que entren a jugar y obtengan un mínimo de puntos recibirán además “premios” en forma de elementos para el ordenador tales como fondos de escritorio, iconos para el messenger o salvapantallas.

A partir del 3 de septiembre y durante toda esa semana habrá en un maratón de juegos.

El maratón consiste en que los niños que quieran participar jueguen los 6 juegos seguidos, sin perder ninguno y reuniendo más de 20.000 puntos.

Los que lo consigan podrán participar en el sorteo de 5 packs de regalos de High School Musical 2.

  • Si este artículo te ha interesado puedes colocar un enlace desde tu blog o sitio web a esta nota.
  • Tus comentarios al pie de este artículo tambien contribuyen a difundir el tratamiento de este tema.

Trilogia High School MusicalLas tres películas de High School Musical para que las disfrutes completas en un único disco Blu-ray.

Consiguela ya mismo la Trilogía High School Musical >>>

Actores: Zac Efron, Vanessa Hudgens, Ashley Tisdale, Lucas Grabeel, Corbin Bleu y Monique Coleman
Directores: Kenny Ortega
Formato: Blu-ray
Idioma: Inglés, Español
Número de discos: 1
Estudio: Buena Vista HE


sasa escribió:
me encanta hig school musical pero no me gustan las canciones
Fecha: 2007-08-03 10:01:26

aracely escribió:
a mi me encanta high school musical, pero tambien me gusta ¡salta¡ porque corbin bleu sale guapisimo (ademas lo adoro).Muchos besos a tod@s l@s fans de HSM y corbin bleu.
Fecha: 2007-08-02 08:51:53

belen escribió:
me encanta high school musical me gustan mucho sus canciones y bailan muy bien tengo muchas ganas de ver la segunda peli. ryan eres muy wapo
Fecha: 2007-07-28 17:24:23

Iris escribió:
me gusta mucho high school musical quiero ver ya su 2ª peli estoy nerviosa....
Fecha: 2007-07-29 13:24:23

elena escribió:
hola me encanta high school de zaragoza.alguien me puede decir si van a ir a tocar a zaragoza??. quiero conoceros y estoy impaciente de ver la segunda pelicula. y ma la voy a comprar.mi actriz favorita es ashley.
Fecha: 2007-09-03 07:44:28

miguel de canet de mar (barcelona) escribió:
Me gusta como actuan todos:Troy,Gabriela,Sharpey,Rayan,etc.Nunca me pierdo los trozos de canciones que salen por la tele de HIGH SCHOOL MUSICAL y ¡SALTA!
Fecha: 2007-08-03 03:41:36

Laura escribió:
Fecha: 2007-08-03 05:01:57

lourdes sosa escribió:
me encanta high school musical y extraño que pasen la película parte4 los quiero hao
Fecha: 2010-11-27 11:46:21

Carolina Taboada escribió:
Lo primero me gustaria conocer a todos los personajes de high school musical a:vane zac ryan ect.Si me puede dar alguien el msn de todos ellos lo agradeceria .Me gustaria tambien ganar muchos premios con los juegos pero para mi lo importante es participar. un beso para todos y buena suerte. ¡os kiero!
Fecha: 2007-07-28 05:55:44

inma escribió:
hola amigos me encanta high school music yo he bailado una cancion de ellos tengo 9 siempre veo las peliculas escucho las canciones y mucho mas............... bueno besos a todos desde el fondo de mi corazon
Fecha: 2007-07-30 10:51:14

CARLA escribió:
high school musical es una pasada y ademas con un monton de musica.Y la musica es de marcha,me encanta ese tipo de musica.High scool musical debe tener mas musica y mas aventuras que guay!!!!!!!!!!!!!
Fecha: 2007-08-03 07:13:55

AGOS escribió:
Fecha: 2007-07-30 17:35:26

maria escribió:
estoy deseando ver la segunda peli a mi me gusto mucho la primera y pienso k se estan esforzando mucho para hacer esos pasos de baile y hacerlo todos a la vez.
Fecha: 2007-07-31 07:58:21

maria navarro escribió:
HOLA!!! okm:laura,elena,irene,cristina,irene,eva,kelly,sara,... y como no tk carlos.
Fecha: 2007-07-31 08:02:44

marikilla escribió:
olaaaa!!!!!los mejores de la peli son chad troy y gabriella y el mas wpo es troy pero en la segunda peli sin la melenita no me gusta asi ke...bueno os dejo xauuuu bss
Fecha: 2007-07-31 09:27:24

judith escribió:
Fecha: 2007-08-03 16:11:09

Maria Belén escribió:
yo pienso que me quiero parecer a Sharpay por que es guapa e inteligente
Fecha: 2007-07-31 14:09:09

Ariadna Vendrell escribió:
yo pienso que los juegos son muy divertidos. vanessa esta rara con el pelo negro y tan poca melena y zac con el pelo castaño igual.
Fecha: 2007-08-01 03:02:14

paula escribió:
yo soy la fan nº 1 de high school musical y sus personajes.toda la gente me dice que soy muy pesada y que solo pienso en esto, a mi me da igual porque me encanta y estoy deseando ver la segunda parte. además ya tengo dinero ahorrado para si alguna vez vienen a madrid(españa)de concieto o a cualuier otra cosa.yo ya estoy jugando a los juegos son muy entretenidos solo e pensar de quien son.ZAC Y VANESSA JUNTOS PARA SIEMPRE
Fecha: 2007-08-01 13:37:05

araceli escribió:
ami me la serie las canciones sobretodo espero que bengan a españa a un concierto porque verlos en persona es genial bueno besos patodos araceli de9 años
Fecha: 2007-08-04 03:32:35

Gloeia escribió:
Ashley ers la mejor y creo que cantas mucho mejor que Vanessa y ers más cañera .
Fecha: 2007-08-04 04:13:37

Lucia escribió:
Me encantan las peliculas de disney, todas son preciosas, por eso estoy deseando que saquen ya la segunda de high school musical 2. La pelicula de salta tambien me encanto, ojala pudiera hablar con corbin blue o con otros de higschool musical. KISS (bss)
Fecha: 2007-08-04 04:21:33

lola escribió:
ola. estoy esperando a q sea septiembre pr ver Hig School Musical 2, POR Q la 1 me gusto mucho. Aqui os pongo mi messenñer.
Fecha: 2007-08-10 14:48:21

unai escribió:
Hola a todos y todas mi nombre es Unai y tengo 10 años y vivo en Bilbao ¿Quieres ser mi amig@?
Fecha: 2007-08-04 14:23:39

venasa escribió:
holaaa me llamo vanesa a mi me justa muxo la pelicula de salta xq sale corbin blue i keke palmer tnb me justa hich scool musical estoy deseando q estrenen la 2 un besoooooo a todos i troy o zac un besazooo vanesa
Fecha: 2007-08-04 15:51:58

celiseth escribió:
te amo zac efron eres el mejor del mundo a y por cierto gabriella eres muy orrrible
Fecha: 2007-08-04 21:54:39

esther escribió:
me encanta high school musical
Fecha: 2007-08-05 08:58:59

rosalia fernandez gutierrez escribió:
Hola me llamo rosalia y quiero decir que me encanta todo lo de disneychannel ,sobre todo los dineychannelgame porque es MUY divertido entrar en la web y verlo .Aaaaa¡ tengo 11 años vivo en sevilla y por yultimo quiero decir seguir entrando en la web y seguir viendo disneychannel¡¡¡¡¡¡ besos
Fecha: 2007-08-05 10:14:51

La Marta escribió:
Fecha: 2007-08-10 17:14:59

susana escribió:
hotel dulce hotel es el programa q me gusta mas de disneychannel mi mns es si beis algunos de hotel dulce hotel escribirme
Fecha: 2007-08-06 06:14:51

yerma escribió:
zac soy tu fan numero 1 y a vannesa lo mateix
Fecha: 2007-08-06 09:29:56

noelia escribió:
high scool musical a dido genial pero a mi lo k mas me a gustado a sido sarpey y daniela y el mas bueno de todos los chicos era corbin blue uuuuuuuuuuuuuuuuuuuu ese si k esta bueno
Fecha: 2007-08-06 09:48:00

elektra escribió:
ola el de high school musical troy (zac efron)esta super bueno me muero por el
Fecha: 2007-08-06 13:17:21

Jennifer escribió:
Me gusto mucho la primera peli espero ke la segunda muxo +
Fecha: 2007-08-06 15:48:34

paula escribió:
high school musical es lo mejor que a podido ensistir muchos besos paula desde madrid
Fecha: 2007-08-30 10:11:12

Idoia escribió:
La primera fue una pasada;la segunda espero que también lo sea para disfrutar aún más que en la primera.
Fecha: 2007-08-07 04:08:37

laura escribió:
high school musical molo un monton y espera k tb la otra troy es guapisiiiiiiiiiimo
Fecha: 2007-08-07 04:35:23

mariel escribió:
me encanta high school musical muxissimo y seguriximo k la 2 es muxissimo mejo. UN BESITO, MARIEL.
Fecha: 2007-08-07 05:06:56

Laura escribió:
hola me llamo laura y me encantaria conoceros de cerca seguro que me encanta la segunda pelicula no os olvideis de escribirme este es mi msn:
Fecha: 2007-08-11 07:48:10

carmen escribió:
hola soy carmen y soy de españa y me se las canciones de high school musical 1 pero las de high school musical 2 no se no se... bueno besos.
Fecha: 2007-08-07 13:15:03

sara escribió:
Fecha: 2007-08-08 04:25:55

yara escribió:
sois los mejores cantantes vuestras canciones hacen flipar y la de high school musical 3 es la mejor es alucinante, os doy mi msn para q me agregeis y me deis la respuesta,agregazme por favor.
Fecha: 2008-08-31 07:16:28

abii escribió:
high school musical es lo mejor i a triunfado un monton i la segunda es la peli mas esperada porque es lo mejor a mi los que mas me gustan son sharpay y troy me gustara que fueran novios porque acen muy buena pareja
Fecha: 2007-08-08 05:22:10

laura escribió:
high school musical es la major peli ke e visto en mi cvida y si la segunda es igual de buena ke si lo creo arrasaran
Fecha: 2007-08-08 07:36:37

ainhoa escribió:
Fecha: 2007-08-11 11:01:51

helena escribió:
ojjjjjjjjjj k wapo eres zac a ve cuando estrenais la pelicula numero 2 a ve cuando veniis por madrid weno wapos . adio
Fecha: 2007-08-21 04:57:51

camila rojas escribió:
hola high school musicalcomo estan soy de chila e y me encantaria berlos en personas porfis bengan a chile besitos a todos chao y soy de 7 años chao
Fecha: 2007-08-11 17:22:07

andrea escribió:
soy la mejor fan k tiene zac efron!!eres lo mejor zac!!
Fecha: 2007-08-08 09:11:28

valentina escribió:
como me mola las serie de high scool musical,es lo mejor de la tele
Fecha: 2007-08-08 11:47:24

miriam escribió:
Fecha: 2007-08-08 12:17:55

nOeLiA escribió:
hola me llammo noelia y tengo 10 años y desde k vi high school musical me encanto como a mi madre a mi padre y sobre todo mi hermano y yo no estoy diciendo que no me guste ninguna de las otras pelis como salta the cheeta girls y otras pero las pelis k mas me gustan son high school musical y salta
Fecha: 2007-08-08 14:08:02

noelia escribió:
hola zak ke sepas k eres el xico k esta mas bueno del mundo bueno y vanesa es muy wapa bueno adiosssssssssss waposssssssssssss
Fecha: 2007-08-08 14:14:15

welington orlando de la cruz mora escribió:
hola soy de republica dominicana y me encanta high school musical y me se todas las canciones de ustedes ademas tengo todas sus peliculas de hsm
Fecha: 2008-12-17 17:37:37

selena escribió:
hola me llamo selena estoy todos los dias biendo disneychannel y hay cosas muy bonitas y muy dibertidas pero lo que mas me gusta es cuando los actores de la peli enpiezan a cantar eso el lo que me encanta y cn la musica me pongo a bailar y tengo una ganas de ver la peli que me muero y asi contarsela a mis amigas bueno no puedo decir mas cosas por que me tengo que ir adios muchos besos para todos los de disneychanel
Fecha: 2007-08-09 08:31:54

Isabel escribió:
Fecha: 2007-08-12 04:19:09

Elisa escribió:
ola soy eli me gusto mucho la peli estuvo fenomenal a y tambien zac y vanesa hacen muy buena pareja estoy deseando ver la segunda,besos chao¡¡¡¡¡guapos!!!!!!!!!!!!!!!!!!!!
Fecha: 2007-08-09 08:34:04

yamilee escribió:
hola soy yamilee y quiero decirles que mi programa favorito es high school musical y mi personaje favoritos son troy bolton y gabriela montez adios y que sigan con su programa chao...ok
Fecha: 2007-08-09 08:38:13

virgi escribió:
a qui se conecta muxa jente muy maja pero quien es el mejor
Fecha: 2007-08-21 13:29:10

Me encanta HIGH SCHOOL MUSICAL,sobre todo Zac es guapisimo.Amí me encantaria ser como ellos y hacer unas pelis tan buenas. Adios . HIGH SCHOOL MUSICAL ES LO MEJOR!!!!
Fecha: 2007-08-09 13:05:13

Nick escribió:
bueno hola a todos miren a los que quieran los msn de ellos solo tengo uno que es el dylan efron pero no se los puedo dar por que si ve esto me Mata
Fecha: 2007-08-21 13:30:21

Laura escribió:
estoy deceeand ke empise la pelicula de high shcool musical 2 y cosa ke no puedo entrar en vuestor jusgos jeje y kisiera jugar
Fecha: 2007-08-09 13:57:32

alba escribió:
Fecha: 2007-08-09 15:59:11

ALBA escribió:
Fecha: 2007-08-09 16:02:46

montse escribió:
no se como se puede jugar no hay manera se blokea el ordenador si alguien sab como k lo diga porfavor
Fecha: 2007-08-12 06:21:18

Aida escribió:
Hola me llamo Aida y estoy con mi hermana Laura. Mi hermana y yo somos las mayores fans de HIGH SCHOOL MUSICAL y tenemos muchas ganas de ver HIGH SCHOOL MUSICAL 2.
Fecha: 2007-08-12 08:59:29

ANONIMO escribió:
Fecha: 2007-08-10 05:31:00

irene escribió:
ola me llamo irene soy fan de ashley me encanta komo canta pero tmb me gusta vanessa kiero su msn el de las dos xdxd weno adios aaa y corbin esta buenisimo y troy tambien tmb kiero sus msn xao os kieroooo
Fecha: 2007-08-10 06:18:43

María escribió:
Lo confieso, soy la mayor fan de high school musical, me encantan todos los personajes, lo se todo sobre la pelicula. Todo lo de mi habitación está decorado de cosas de HSM, posters, fondo de pantalla, protector de pantalla, iconos de mesennger, su disco, su pelicula... y fijaos si me gusta, que ya me se todas las canciones de la segunda pelicula. Bueno, solo digo que: ¡¡¡¡¡¡¡¡¡ARRIBA HIGH SCHOOL MUSICAL!!!!!
Fecha: 2007-08-12 11:42:17

mario escribió:
me encanta high scool musical
Fecha: 2007-08-12 13:04:30

beatriz escribió:
hola soy beatriz megusta todo lo ke azeis en disney channel. y yo tanbien esto be en una peli de pekeña.toma os doy mi messenger a ver si podemos ablar: yo vivo en rosas cataluña, siempre ace sol y me gustara mucho ke bengais a roses azer unos bailes...!!.es pero ke ablemos y tanbien megusta las chitagels y me gustaria ke tan bien me ablen bueno os es pero chao guapas o adeu como se diria en catalan.muaaaaaaaaaaaaaaaaaaaa.
Fecha: 2007-08-13 07:13:58

aqua escribió:
me llamo aqua quiero conoceros algun dia,te quiero corbin
Fecha: 2007-08-13 10:26:34

esther escribió:
hola soy Esther tengo 10 años y me encanta high scool musical quiero conocer a todos tequiero zac efron a y mi prima esta por corbin brabo por todos
Fecha: 2007-08-13 12:49:42

sofia escribió:
hola les queria contar que me encanta la peli de high school mucical1, bamos por la 2. zac te re quiero y m re gustas, n me importa los luks que te agas siempre sos hermoso. corbin sos lindo pero no me gustas mucho, quedas re lindo si te atas el pelo. venes te amo y ojala que en la vida real salgas con zac porque son muy simpaticos.asley sos muy linda ojala que salgas con corbin y no con zac TE AMO. CHICOS LOS RE QUIERO Y SE LES PASA ALGO ME MUERO , ESTOY MUY TRISTE POR NO ABER IDO AL CONCIARTO ES QUE SOY DEL INTERIOR. Y NO PODIA IR CHAUUUUUUUUUUUUU LOS AMO
Fecha: 2007-08-14 08:23:36

nico escribió:
me gusta mucho high school musical y asley tisdale esta buenisima
Fecha: 2007-08-14 08:28:01

izaskun escribió:
soys mis mayores fans
Fecha: 2007-08-14 08:44:46

macarena escribió:
Fecha: 2007-08-21 16:03:32

silvia escribió:
bueno ps kiero decir ke adelanten la fecha de high school musical 2 porke las chicas ya no podemos mas keremos ver a zac (troy)
Fecha: 2007-08-14 12:47:57

aida escribió:
o osdigo k me gutays mucho como cantais
Fecha: 2007-08-14 12:58:35

almita escribió:
hola a los de hsm 2 como an estado ¿¿? aver cuando vienen para guaymas bueno mlos dejo bayyyy
Fecha: 2007-08-14 17:47:32

sofy escribió:
Fecha: 2007-09-03 15:03:35

alba escribió:
hihg school musical 2 es la mejor pelicula de esta tenporada de verano, es la mejor votada por todas las personas ¿ teneis que venir a valencia ? me gusta mucho buestras pelicula . zac & gabriela
Fecha: 2007-08-15 05:37:31

adriana escribió:
gabriela y zac me caen super bien espero ber su peli en Septiemmbre la pena esque no los alla podido ber y si me enbian un imeil no lo podre ber porque no me deja el ordenador entar en correos si quieren pueden agregagarme con mucho gusto de hablar con ustedes bibo en la cuesta(tenerife) se que es muy lejos pero me da igual ya saben!!me llamo adriana y agreguenme y espero que lo agan y sarpey y rayan tabien me caen bien y tus amigos los morenitos...Bueno espero conocerlos y berlos y....Un Beso Grande!!
Fecha: 2007-08-15 07:04:14

mireia escribió:
high school musical es la mejor pelicula que e visto de disneychannelsrpay creo que Sarpay es muy pija pero su ropa me encanta i creo que es muy guapa i Gabriela tambien i Zac tambien es muy guapo a Sarpay le gusta pero Zac quiere a Gabriela
Fecha: 2007-08-15 12:19:10

[-->P@ul¡ta<--] escribió:
Troy stas q wenisimo¡¡¡ Gabriela cantas genial y eres super mona. Sarpay eres mu wapa cantas genial y me encnta cmo actuas¡¡ besotes a toos o's qero¡¡
Fecha: 2007-08-15 13:19:17

camila duarte escribió:
hello and mi cami and mi incanta high school musical soubre todo zac efron
Fecha: 2007-08-15 16:29:19

josefina escribió:
hello!!bueno les queria comentar que los juegos ya los jugue y estan re buenos.Pero no vi la peli porque no salio,pero el 22 de este mes ya sale asique la voy a ver ni por joda me la pierdo debe estar re buena.Bueno me voy y chau los voy a estar viendo,a y les quiero decir que soy de Dolores un pueblo chiquito de la bs as y tengo 10 años.bye bye
Fecha: 2007-09-10 17:29:14

ainara escribió:
high school musical me encanta porque me gusta cantar y bailar.Tengo la peli y tambien me voy a comprar la segunda.
Fecha: 2007-08-16 04:06:31

noe escribió:
ola wap@s!! weno k ami me ncanta disney channel y k m gustaria conseguir algun msn de high school musical o mejor veros en persona puff me encantaria weno muxos bss y k siempre k veo la peli.. me emociono xk me gustaria k me pasase ami muxos besos noe!!
Fecha: 2007-08-16 05:51:16

carla escribió:
Hola me gusta tambien high school musical y buestras canciones. Estoy deseando ver la segunda pelicula. Espero que sea tan "chuly" como la primera. =)
Fecha: 2007-08-16 08:35:31

edurne escribió:
ola me llamo edurne zac eres my idolo gabriela tu tambien y todos los demas estoy deseando de ue salga la peli de hig school musical 2 porque la quiero ber en los cines un beso para todos
Fecha: 2007-08-16 08:46:02

Paula escribió:
Hola mi nombre es Paula y me encanta High School Musical,¡Salta¡,las Cheetah Girl1y2yme encanta tambien Hotel Dulce Hotel
Fecha: 2007-08-16 09:27:29

Karol escribió:
Fecha: 2007-09-04 05:21:14

flavia escribió:
sharpai ryan troi gabriela chad y tailor son mis mallores anmiradores espero que en high school musical 2 le balla bien les dedseo suerte a todos de flavia su mallor anmiradora
Fecha: 2007-08-16 11:35:06

Diego Alfonso escribió:
Gabriela no te enamores de Troy que es un gafo
Fecha: 2007-08-29 16:53:48

jose maria escribió:
hola me llamo jose maria soy de santomera murcia y me encanta salta the cheetah girl 1 y 2 y tambien todo sobre ruedas
Fecha: 2007-08-17 03:59:26

beatriz escribió:
tengo muchas ganas de k se estrene la pelicula de high school musical 2
Fecha: 2007-08-17 06:03:36

albuxi escribió:
ola m encanta hsm y sobretodo m encantan los personajes(vosotrosjj)sois los mejores y espero knoceron sobretodo a corbin k me encanta y espero k salga la peli pronto tngo muxas ganas d verla k os vaya ben muxos bsss os kiero
Fecha: 2007-08-17 09:26:53

gabi escribió:
high school musical los quiero muchoooooooo tengo los cuadernos de ustedes yo soy de republica dominicana ahora quiero el poster
Fecha: 2007-08-29 19:47:42

Lorena escribió:
Fecha: 2007-08-17 10:20:59

paula escribió:
ola chicos kiero k sepais k sois los mejores,soy fan de zac y sobretodo de corbin . Corbin kiero k sepas k me encantaria konocerte y a vosotras chicas tambien ,corbin o zac xfavor si teneis msn darmelo xfavorrr!!! muxos bss os kiero mazo
Fecha: 2007-08-22 11:50:51

ainhoa escribió:
Fecha: 2007-08-22 12:03:48

aranza escribió:
zac te quiero mucho y a vanessa y a todos los de high school musical los amo y mas a zac todas las noches piensa en ti y si tu ubieras ido al concierto estuviera gritanto hasta que se me acabara la voz auque no vives donde yo vivo tu para mia eres mi novio ojala que lo leas
Fecha: 2007-08-17 12:03:53

daiu escribió:
hooolaaaa me encanta high school musical y tambien soy la fans n°1 de Zac Efron y de Vanessa Hundgens encima,no se si lo saben pero Vanessa y Zac son novios y me encanta la pareja q hacen les doy la direccion para q entren y vean:LOS MEJORES NOVIOS VANESSA ANNE Y ZAC EFRON esa es la direccion entren y fijensen.chau me voy byebye
Fecha: 2007-08-17 18:14:40

carla escribió:
hola zac sos un bombon de dulce de leche!!! y esa vanessa es una trola no se como te gusta ella yo i love y vs i love??
Fecha: 2007-08-17 18:54:58

natasha escribió:
hola me gusta disney channel y quiero que ya estrenen high school musical 2 pq soy fanatica de sus bailes y se ve padre la peli
Fecha: 2007-08-22 16:21:00

Carolina escribió:
Holaaaaaaaaaa me encanta high school musical y high school musical 2 tambien me gustara soy la fan nº1 ¡viva high school musical 2!
Fecha: 2007-08-18 04:18:10

raquel escribió:
hola me encanta high school musical vanesa eres wapisima y truunfaras en muchas pelis sige asi wapa tu fan num 1
Fecha: 2007-08-18 08:50:46

arancha escribió:
no se como hacer para entrar en los juegos por favor si alguien me lo puede explicar se lo agradecveria mucho por favor
Fecha: 2007-08-18 09:13:51

martina escribió:
Estoy deciando jugar a estos juegos.!!! son los mejores xD jajajaja miis personajes preferidoS SON: troy bolton=zac efron. eres super tope wapo xD eres muy bonito te kiero wapoo te amoooo.
Fecha: 2007-08-18 14:03:47

Jordi escribió:
Hola! Soy uno de vuestros fans favoritos, desde que que enpezasteis la nueva pericula de High School Musical no pude de dejar de ver vuestra pagina web, me encanta vuestra voz cantais jenial, a porcierto me encanto el videoclip de vanessa de say ok y come back, espero ansioso de que saqueis High School Musical 2, un veso de vuestro mayorcisimo fan jordi. Os quiero!!!
Fecha: 2007-08-23 06:20:10

angela escribió:
esta to guapa tendria q verla otra vez
Fecha: 2007-09-04 04:03:00

noelia escribió:
mola mxo jeje
Fecha: 2007-08-19 06:20:14

arturo escribió:
ola amigos¡¡¡¡¡¡¡¡ me encanta high school musical y si os digo la verdad xicas engo el msn de troy y gabriela si lo kereis agregadme y os lo doy mi msn es y tengo 13 años
Fecha: 2007-08-19 10:28:02

paula escribió:
hasli eres mi fan n 1 te kiero
Fecha: 2007-08-19 13:22:40

vanessa escribió:
wooola yo pienso que ba a estar pagre high school musical 2 pero seria mejor que zac estubiera con ashillye bye
Fecha: 2007-08-19 17:13:47

Elena escribió:
hola rayan eres el mas guapo de todos a los demas no os enfadeis k tambien sois mu guapos
Fecha: 2007-08-24 03:44:44

maria escribió:
me encanta disneychannel.mi serie FAVORITA ES HANNA MONTANNA.ME ENCANTAIS WAPOS
Fecha: 2007-08-24 07:29:50

deboraL.S escribió:
hola soy debora,pues son todas estas:Hanna Montanna,high school musical2,raven y hotel dulce hotel espero ke vallais a sacar high school musical 3 soy un fan sois los mejores a ke sharpay tu tambien estas en hotel dulce hotel hay estas muy guapa yo se ke sack y cody son los dos italianos anda tu para entenderlos adios
Fecha: 2007-08-24 09:38:47

alexandra escribió:
es lo mejor y mas el estreno de high school musica2 no mecanso de escullar la cancion
Fecha: 2007-08-24 15:05:44

monica escribió:
oigan todvia no veo la peli pero pienso ke va a estar bien chida y la ters ke bueno ke tambien van a hacer tres ok bye me encantaria conocerlos atodos soy su fan number one jajajajaja jejejejeje jijijijij jojojojoj jujujujujuuju bueno tambien a muchos otros artistas pero mas ke nada a ustedes 6
Fecha: 2007-09-12 15:35:16

shara segura y kiara escribió:
hola, me llamo shara, soy de barcelona y tengo 10 anyos... zac efron estas tremendo wapiiiiiiii me gustaria verte... eso... lla saves... bueno, pues nada que te quiero con locrua si me quieres conocer i acer un poquito... eso... lla saves... pos mi messenjer es: adios
Fecha: 2007-08-25 12:19:10

karla escribió:
bueno no puedo jugar pero me gusta saber q zac efron este con vanssa ella es linda pero me caen las dos a si que sean feliz los tres y asley no sufras te quiero bye.
Fecha: 2007-08-30 21:36:13

sara escribió:
zac esta rekete bueno
Fecha: 2007-08-26 06:30:07

Eva escribió:
hla a tos!! h visto high school musikl 1 y m a nkntao.solo dseo k high school musikl 2 sea tan wena kmo la 1ºa y ke tos la disfrutmos muxo n!!:MUXISIMO!! bsos a disney xannl y thanks x sr 1 knal tan wen!!
Fecha: 2007-08-31 04:54:58

lidia escribió:
zack esta buenissimo!!!!! aber si da buena suerte y bienes a barcelona!!! me gusaria ber a todos jejeje me gustaria k me dejaran jugar a high school musical 2
Fecha: 2007-08-31 05:39:39

yaz escribió:
Zac no te puedes imaginar lo que me gustas..tengo posters tuyos por todos lados y estas como un queso...para mi no tienes ningun defecto...T.K.M..hasta cuando me entere que venias a españa me puse a llorar!..px te amo muxixixixixixiximo!no se como la super primerisima fan de zac efron y me encanta high school musical..tengo todos sus cosas hasta camisetas y estuches...y hasta una manta de zac efron!!!!...te amo te amo y te amo wapisimo nunca cambies
Fecha: 2007-08-26 06:41:06

BEA escribió:
Soy la mayor fan d HIGH SCHOOL MUSICAL,ZAC EFRON Y VANESSA!!!!Zac you are the best,tngo mi habitacion llena d posters tuyos!!xfavor zac y vanessa teneis k acer la tercera peli d HIGH SCHOOL MUSICAL!!!Acerlo x vuestr@s f@ns!!soy d cordoba!! os kiero un monton!!y a corbin tb!!y os digo una ksa ay muxa gnte k pide vuestro msn pero no ace falta k lo deis!!me encntaria verte Zac!!!!!I LOVE YOU!!!KISS FOR YOU
Fecha: 2007-08-26 06:41:40

ANONIMO escribió:
Fecha: 2007-08-26 06:50:51

shirley escribió:
troy bolton esta como un keso k se derrite
Fecha: 2007-08-31 13:48:52

maria escribió:
que guai es disney channel , t hotel dulce hotel , sack eres el mas guapo eres el mejor ¡sack te queremos!
Fecha: 2007-09-04 07:13:54

paula escribió:
high school musical son los mejores ,zac esta buenisimo pauly
Fecha: 2007-08-31 16:03:26

martinez 1* escribió:
Fecha: 2007-08-27 04:55:52

ana escribió:
soys los meores os kiero muxo
Fecha: 2007-08-27 07:21:41

laura escribió:
me gusta micho zac efron me muero x sus huesos
Fecha: 2007-08-27 10:35:25

marlen escribió:
yo dreo que zac y vannesa no hacen muy buena pareja.mas vien seria zac y aslhie.Bueno de todas maneras HSM es el mejor y desespero por ver la segunda peli
Fecha: 2007-09-01 03:11:13

zoe escribió:
ami me gusta corbin mas alguien tiene el msn de algun famoso.por favor escribanme a
Fecha: 2007-08-27 10:50:45

maria elena escribió:
hola tengo 12 años y me encanta high school musical ya cuento los dias ke faltan pa el estreno de su new^nueva peli
Fecha: 2007-08-27 13:11:41

aaron escribió:
yo se k tu me kieres pero andrea de camvio de cl
Fecha: 2007-08-27 14:02:22

camila escribió:
hola a todos les qiero desir q si me puee dar el msn de la asheley
Fecha: 2007-08-27 18:12:35

rocio escribió:
me gusta mucho como actuan , como cantan , bailan muy bien y vi todas sus pelis. sigan haci que a todos les gustan sus pelis.les prometo que voy a ver high school musical 2.besos a todos y que vivan las chicas.
Fecha: 2007-09-01 03:22:19

Pilar escribió:
zack esta buenisimoO!!! si aguien tiene su msn q me lo escriba q ya leere su os sabes el de corbin bleu tambien.chaitoO!!!
Fecha: 2007-08-28 05:46:01

nazaret escribió:
me vuelve loca zac efron es un y me gustaria conocerte en persona y a ti zac martin[hotel dulce hotel]me encantan tus travesuras xao tios buenos tengo 11 años
Fecha: 2007-08-28 08:35:44

maria escribió:
high scool musical es lo mejor , zack eres quapiiiiiiiiisimo , te quiero muxiiiiiiiiiiiiiisimo , tengo toda mi habitacion llena de posters tuyos .zack efron t.k.m
Fecha: 2007-09-04 07:19:37

cristina escribió:
Fecha: 2007-08-28 11:37:38

Lety escribió:
Holaaaa me encanta y adoro HSM2 es chulísimo y sobretodo hay que darles ánimos a todos los chicos y chicas por todo el esfuerzo de los bailes que para coordinar todos juntos es muy difícil y la película me ha enkantado muchos besos...: De Vuestra Fan Número Uno: Leticia.
Fecha: 2007-09-01 08:01:55

laura y karla escribió:
Hi!!We are your best fans!!We love your film, Zac,we like know you and your friends of High school musical.What is your girlfriend?Is she Vanessa?We love you. We are from spain.Sorry for the fault. We are13 years old
Fecha: 2007-09-01 11:34:57

TRIANA escribió:
a ver si viene high school musical 2 a almeria!!!!
Fecha: 2007-08-29 07:41:13

nadia escribió:
asley eres estupenda ojala pudiera ser como tu ademas de tener tu voz.zac me encantaria conocerte eres estupendo ademas de guapo . ojala te conociera para tenes tu msn.corbin bleu eres mu mayor fan ojala te conociera e hiciera el papel de la chica en salta te quiero un monton eres estupendo un beso PARA TODOS sobretodo a asley y corbin. agregadme please.XXX
Fecha: 2007-09-01 13:27:40

micaela escribió:
me ban a dejar jugar a high school musicl 2
Fecha: 2007-08-29 11:12:39

paula escribió:
me encanta high scholl musicl si pudiera berlois en person a seria lo mejor pero no puedo porque haunque vivo en murcia capital nunca bienes famos que me gusten y menos high school musicl.
Fecha: 2007-09-02 05:41:26

adoro high school musical,son los mejores d todo el mundo de las pelis y su banda sonora es total.pero como soy murciana no los podre conocer.pero yo no pierdo esperanzas.besazos high school musical!
Fecha: 2007-09-02 07:41:27

maria victoria j. gomez escribió:
high school musical,los adoro soys los mejores y en especial gabriella,las canciones son bastante originales,pero como soy gaditana no los podre ver en persona.muchos besos y muchos abrazos para high school musical!
Fecha: 2007-09-02 13:10:04

cristina turegano font escribió:
Que guay HSM es lo megor que ai en el mundo aparte de mi familia .Somy de L´Hopitalet. Muchos vesos i muchos abrazos para HSM de parte de cristina.MUA
Fecha: 2007-09-02 13:52:51

chelcie escribió:
high scool musical es super cool y osea la primera parte fue super la segunda en buen plan va estar buenisima o no
Fecha: 2007-09-02 18:35:37

€Li$a escribió:
esta muy bien deberian hacer un video juego sobre estoo
Fecha: 2007-09-03 06:36:40

andrea escribió:
lo mejor es high school musical 2 lo vere el disney chanel devo dar las gracias a dysney chanel....gracias
Fecha: 2007-09-13 07:19:18

andrea escribió:
eres mi mayor fan ZAC igual que todos quiero que me agregeis os kiero mucho se ablar un poco ingles kisiera conoceros pero no me gusta ke vanesa este con el morreandose por todos los sitios en la playa etc...high school musical me encanta y estoy segura de ke high school musial 2 creo ke me va a gustar muchisimo más.NO digo ke vanesa no sea guapa pero jode ke te beses con ella porke tu puedes a encontrar muchisimo mejor sige asi contestame porfa y contestame tanbien por esto va a aver high school musical 3 contestame y dime tu msn porfa vor adios e sido muy sincera contesta pronto porfa
Fecha: 2007-09-11 05:16:14

maria escribió:
me encanta high scool musical porque a mi me encata cantar.Ademas sois todos guapisimos.Soy una gran fans de high scool msusical.¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡Buena suerte a todos!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!WAPISIMOS
Fecha: 2007-09-04 08:17:13

claudia escribió:
ola zack soy claudia parami eres guapisimo estoy enamorada de ti.
Fecha: 2007-09-11 06:29:57

david escribió:
high shcool musical es la bomba am i m'agrada en ryan
Fecha: 2007-09-11 06:43:02

bea-bea escribió:
os quiero mucho bs
Fecha: 2007-09-11 07:25:51

Laura escribió:
High school musical 2 sera una peli autenticamente highschoolmaniatica. Comentario para Zac Efron para el mas guapo i sales en la revista bravo. ¿Es verdad que sales con Vanessa hun geus?. Pero tambien son muy guapas las chicas Aslhey,Vanessa y Monique tienen un gran talento para bailar y cantar.
Fecha: 2007-09-04 13:12:46

kiko escribió:
kierom q se conecte todo lo q tengo agregao
Fecha: 2007-09-11 07:44:17

maria escribió:
sos kiero muxo pero sharpei eres mu wapa eeeee zac estas como es pan
Fecha: 2007-09-11 08:02:51

yaiza escribió:
ola quiero mandar les un veso ha todos los de high school musical por que lo hacen estupenda mente y les quiero decir ha todos que me hagregen pàra hablar con ellos una veso y os lo digo de ermua y tengo 10 años chao guapos
Fecha: 2007-09-04 15:05:47

maitane escribió:
zak y gabriela sois los mejores sois mis fans Nº1 os kiero porfa agregarme pliss mss besos
Fecha: 2007-09-04 15:12:32

carlos escribió:
sharpay estas vuenisima eres la mejor
Fecha: 2007-09-11 09:52:49

laura daniela escribió:
soy alucinantes aunque los juegos de disney channel qu son buestros son dificiles soy una argentina que despues se fue a bibir a colombia y despues a españa cataluña - girona fiqueres y tengo 8 años bueno chao besos y espero que me escribais bayyyy bayyyy xxxxxxxxxxxxxxxxxxxxx besos
Fecha: 2007-09-11 11:44:03

Amarantha jose petit colls escribió:
hello como estan los admiro muchoooo ok quiero que me agregen ok zac y ashley tambien vanessa y todo el elenco de high school musical ok es
Fecha: 2007-09-04 20:54:34

Ashley Tisdale escribió:
I love you Zac Efron you my boyfriend
Fecha: 2007-09-05 04:18:41

paulita escribió:
high school musical es lo major aun k salta!!! esta super xulo zac es wapiissimo y ashley actua d miedo cuando se estrene la segunda peli de hsm me pondre super hapi. besitos
Fecha: 2007-09-05 05:28:15

aburrida!!!!! escribió:
me aburro muxo y me gutan las series de disney channel bastante....y tembien la ppeli de high scoohl music !!!!! XAO!!
Fecha: 2007-09-05 08:51:45

ROXANNE escribió:
Fecha: 2007-09-05 09:05:56

aleida escribió:
yo soy buestra mayor fan y me se todas vuestras canciones madie y sharpeitu hacesdos papeles increibles chaito london
Fecha: 2007-09-11 12:43:13

elizabeth escribió:
espero k les vaia muy bn!!!!!!!!!!!!!! es super buena su pelicula io ia me aprendi toos los pasos espero k triunfen mil kiss adioz!!!!
Fecha: 2007-09-05 17:31:17

cristina escribió:
wenas me llamo cristina y tengo 11 años me gustan muxo las pelis de disney channel la de las cheetah girls esta xula la de salta pero la de high scohool musical 2
Fecha: 2007-09-06 04:56:59

jm escribió:
j:HIGH SCHOOL MUSICAL es super xulo una pasada todos son los mejores me he enganxado a la peli y a las canziones. m:HIGH SCHOOL MUSICAL pensaba que era un aburrimiento pero cuando lo vi me gusto y desde entonces me encanta:).
Fecha: 2007-09-06 05:10:33

julia y mireia escribió:
somos la de jm nos emos hemos ekivokado y hemos puesto otro nombre HIGH SCHOOL MUSICAL a tope!!!!!!!!!!!!!!!!!!!!!!!! somos fans
Fecha: 2007-09-06 05:17:37

paula escribió:
zac corbin lucas os amooooooooo ashley gabriela soys muy guapas soy fan de HIGH SCHOOL MUSICAL os quierooooooooo
Fecha: 2007-09-06 05:35:44

ana escribió:
Fecha: 2007-09-06 05:54:47

lucia escribió:
yo se de donde son los gemelos zack y cody si queris saberlo os pongo mi
Fecha: 2007-09-06 10:04:33

lucia escribió:
hola soy yo otra vez los gemelos en la realidad tambien son hemanos tengo fotos de hellos y son los ismos apellidos estan las fotos con sucara y camideta nobre y firma si las quereis meteros en en la premera q os sale pinchais luego arriba en disney channel games y en sobre el juego y uno es del equipo azul y otro del verde y si quereis jugarcon ellos donde le emos dado para mirar sobre los juegos allado te sale jugar a los juegos le das y juegas a juego de a semana si quereis otro juego le dais a mas juegos y os sale orto tambien podeis envias las puntuaciones a concurso y mirarlas puntuaciones tambien .... un besito adios.
Fecha: 2007-09-06 10:30:32

laura ¡¡¡¡ estoy muy loka !!!! escribió:
me encanta high school musical ¡¡¡¡¡¡¡ esssssssssss una paaasadaaaa tambien me gusta hannah montana igual que hotel dulce hotel asique lo unico que me keda decir es I love a lot disney channel la verdad es k estoy muy loka por eso alargo las paaaaaallaaaaaabbrrrraaaaaaaaas ji ji ji bueno un super beso a todos los amantes de disneychanel y haigh school musical
Fecha: 2007-09-12 06:30:55

alejandra escribió:
high school musical fue muy bonito me gusto mucho lo que pasa esque ashley cantando fafules rompe un poco los oidos que no es broma es su papel lo tiene que hacer muy bien en la pelicula
Fecha: 2007-09-06 20:08:51

encarni escribió:
ola soy encarni de almuñecar. Quiero decir que me encanta high school musical 2. Me encanta la musica de andrea y sus bailes...adios bss.
Fecha: 2007-09-07 05:03:57

sara escribió:
HOLA SOY SARA TENGO 10 AÑOS.Zac estas buenisimo,me encanta HIGH ESCHOOL MUCICAL tengo muchas gana de k enpiece la 2 peli tengo el disco, a k se me holbidaba Zac me puedes dar tu msm el mio es
Fecha: 2007-09-07 05:36:11

xana escribió:
bueno si me gusto mucho le voy a decir a mis amigos q entren en esta pagina.
Fecha: 2007-09-07 08:32:48

maria escribió:
Hola soy Maria tengo 8 años , me encanta la pelicula.El personaje que mas me gusta es Ashley. bueno adios MAriA.
Fecha: 2007-09-07 11:32:11

laura ¡¡¡¡ estoy muy loka !!!! escribió:
I love haigh school musical y disney channel
Fecha: 2007-09-12 06:33:55

juan colchero escribió:
ola me llamo juan alguien me podria decir la pagina de los disney channel games kien kera decirmelo se me ola me llamo tal escribo para juan mira la pagina es........ y me pone como es weno oye asley es mi amor bs
Fecha: 2007-09-14 12:33:48

selena escribió:
me encanta high school musical zac eres muy guapo y tu tambien vanessa y tu asley soy todos muy guapo mi msn es y el vuestro estoy super nerviosa por veros a todos y sobreto a zac y a vanessa.yo vivo cerca del campo de giblaltar en san roque un pueblo de cadiz vais a venir alguna vez por favor . besos a todos y sobretodo a zac y a vanessa guapos
Fecha: 2007-09-14 08:48:29

Paula escribió:
Hola me llamo Paula y tengo 13 años, soy de Valencia.Que sepais,que a todos los actores d HSM, os deseo muxa suerte en el 2 rodaje de la peli HSM. Estoy deseando con orgullo que se estrene HSM2,XQ EL año pasado la pelicula fue un exitazó y este año tendrá el doble d éxito. Todo el mundo esta impacient. Bueno eso es todo Bexitos xra chat,taylor,gabriella,troy,rayan y sharpey. D parte d PAULA
Fecha: 2007-09-07 15:55:51

jorge escribió:
hola a todos los de hsm k tal este año vas a madrid vanessa esta to buena diselo de mi parte vale zac dew tio soy tu mayor fan xxxxxxxxxxxxxxxxxxxxxxxx
Fecha: 2007-09-07 16:01:47

sara pinto gonzalez escribió:
todo el mundo habla sobre high school musical 2 yo soy nueva en esto y nunca lo e visto pero creo que sera un bombazo aun asi ami me gusta hannah montana
Fecha: 2007-09-14 04:36:55

coconytha escribió:
bUeNo A mI mE eNcAnTa HIGH SCHOOL MUSICAL Y ME ANCANTA ZAC EFRON Y SOY ADMIRADORA de troy bolton (zac efron) y de gabriella montez (vanessa anne hudgens) enserio los amo soy fans de ustedes son lo mejor y me gustaria que todos me mandaran un correo electronico ¡porfissss! por siempre admiradora de ustedes ****____conytha____****
Fecha: 2007-09-07 22:11:09

maria del mar escribió:
zac estas buenisimo me gustaria conocerte
Fecha: 2007-09-08 05:29:52

maria del mar escribió:
hello zac your is beutiful and me is agly sa_maria_loka_94
Fecha: 2007-09-08 05:33:11

uribarri escribió:
quiero conocer a zac es guapo mola mucho
Fecha: 2007-09-08 06:24:56

sara escribió:
ola yo kiero conocer a la rubia y a corbin pero yoi kiero berlos y todo y k m mandas un video k diga mi nombre y el msn de todos eyos muxas gracias jejeje lkm
Fecha: 2007-09-08 08:26:56

manuel san escribió:
en que juego de high school musical 2 hay que encestar
Fecha: 2007-09-12 10:06:50

Angela escribió:
Fecha: 2007-09-08 08:55:07

Afri escribió:
Fecha: 2007-09-08 14:36:47

maria escribió:
high school musical es la mejor peli q e visto soy maria os recomiendo la peli¡¡¡¡¡¡¡¡¡¡¡¡¡
Fecha: 2007-09-13 11:07:12

nira escribió:
me encanta la la pelicula de high school usical no solo por que es bonita sino que me gusta como actua zac efron y es tan lindo que cualquiera quisiera estar con el
Fecha: 2007-09-09 18:22:03

paulina escribió:
me encanta es el mejor tengo los cidi tengo poster de todo de ellos me encan asta la cama de ellos los amo
Fecha: 2007-09-09 18:50:31

alba re escribió:
os quiero mucho ooooooooooooo siiiiiiiiii no pares sigue sigue
Fecha: 2007-09-10 07:37:07

lidia escribió:
esta muy bien estoy deseando que echen la pelicula de high school musical 2 ¡quiero verla¡ esta chuliiiiiiiiiiiiii espero que seais españoles
Fecha: 2007-09-13 14:37:46

alba escribió:
me encantahsm me gustaria conocer a los personajes en persona os doy mi msn porfavo agregadme
Fecha: 2007-09-15 10:33:01

clara escribió:
hola soy clara soy fan de zac y vanne y me encanta high school musical 2 ¡sois lo mas!xao
Fecha: 2007-09-17 08:08:59

nahir escribió:
hola ya me llamo nahir y soy muy fans de zac , asley y tb de vannessa, me gusta mucho las canciones y espero que bengan a dar su concierto a Bolivia
Fecha: 2007-09-15 10:54:17

coco escribió:
zac t kiero no se como algien pued star tn bueno.m llamo coco y tngo 11 años.
Fecha: 2007-09-15 14:45:07

valentina escribió:
vanessa me gusta tu estilo eres muy simpatica y linda me gusta como cantas y bailas eres super zac eres el mejor eres lindo me gusta como eres tu forma de actuar y cantar eres super ashley eres encantadora y lindsa me gusta como actuas el la peli jaja eres talentosa
Fecha: 2007-09-15 21:27:37

disneyfan escribió:
ashli tislay , zac , vanessa y corbin me encanta me encanta high school musical jejj tambien me encantan zac y cody muac u n beso xaooooo!!!!
Fecha: 2007-09-16 03:08:17

carlota escribió:
me gustaria ver a sapey
Fecha: 2007-09-16 04:44:17

maria camila escribió:
hola atodos soi maria camila les hablo desde la ciudad de madrid y queria de cirles que sois geniales sobre todo lucas gabreel
Fecha: 2007-09-16 08:34:51

saida escribió:
me encanta zac estoy enamorada de el y me encantaria conocerle es la persona que mas adoro y quiero decir una cosa ¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡ARRIBA ZAC EFRON!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1
Fecha: 2007-09-16 09:06:56

irene escribió:
hola soy irene tengo 8 años y me encanta high shool musical y vanessa sin ti y sin zac no seria nada la peli ni high shool musica 2 me va a emocionar vueno adios este es mi massenñer
Fecha: 2007-09-18 08:04:28

maricuxy!! escribió:
Hola buenas!!queria decir que me encanta high school musical y tambien zac efron y asheley tisdale(no se muy bien como se escribe) son los mejores y que si tu viera la oportunidad de decirles algo le deria que son los mejores y que lo valen porque se lo curran mucho.Bueno besos para todos los de high school musical y a tod@s sus fan .
Fecha: 2007-09-18 10:34:42

maria francisca escribió:
soy amalia y les queria contar que high school musical fue la mejor pelicula de todos los tiempos , seria capaz de pagar 25 millones de dolares si los tuviera para ver a ashley , a zack, a vanessa hudgens, a corbin blue , a monique y a todos . YO soy su fan nro 1 y los adoro a todos ellos AHHHHHHHHHHHH!!!!!!! no puedo esperar mas para ver high school musical 2 , dicen en disney channel que esta peli va a ser mejor que la otra . NO PUEDO ESPERAR MAAAAAS!!!!!!!!!!!!!!!!!!!!!!!!
Fecha: 2007-09-18 13:56:10

Florencia escribió:
ola!! me encanta high school musical 1y2 son lo mejor de disney channel Vanessa eri lo mejor con Zackary Efron=) qiero ver la peli no me aguanto + x verla qiero q sea el sabadooooo XD weno xauuuuu!!!!!!
Fecha: 2007-09-19 15:42:12

carlos andre escribió:
me encanta high school musical te amo ashley me pareces super bonita te amo . quiero iconos de high school musical
Fecha: 2007-09-20 06:33:13

irene escribió:
hola zac hola vannessa hola ashli hola lucas hola corbin hola bonique me llamo irene martinez ramos quiero de cir que quiero a zac y tambien mis dos amigas inma marina
Fecha: 2007-09-20 07:45:36

pilar escribió:
high school musical es la mejor pelicula del mundo y gabriella troy brayan y ashley
Fecha: 2008-08-31 05:44:54

anna escribió:
high school es lo mejor pero zac esta buenissimo y esta como un el mejor actor que he visto
Fecha: 2008-09-02 04:36:07

anita escribió:
son mentiras yo soy la fan numero uno de ZACCCCC y lo publique por SMS arriva para que todos lo sepan yo soy anita la fan numero uno de zac, sepanlon, sepanlon
Fecha: 2007-09-20 09:48:33

Angela escribió:
hola soy angela haceis muy bien la plicula de high school musical . un beso muuy fuertede vuestra amiga ANGELA
Fecha: 2007-09-20 10:42:25

bastian escribió:
me gustaria que me digan como le an ido con saludos bastian black
Fecha: 2007-09-20 10:43:56

$OFI@ escribió:
soy una gran fan der hsm tengo casi todas sus cosas jeje(una friki)besos sofi xd
Fecha: 2007-09-20 13:45:24

vanessita escribió:
vanessa es la mejor y si ace wena parja cn zac efron adms es wapisima y lo k teneis es envidia d vanessa por str cn zac en la playita de hawaii dandose morreos ENVIDIOSOS la envidia nu es wenaaaaaa
Fecha: 2007-09-20 14:44:13

cristina escribió:
hola me llamo cristina y me gustaria que hig school musical viniese a albacete a hacer un concierto
Fecha: 2007-09-21 09:24:19

selina escribió:
hola me llamo selina y quisiera conocer a todos les cantantes
Fecha: 2007-09-21 09:04:42

anonimo escribió:
Me gusta mucho Dylan sprouse y me gustaria teenersu msn el mio es
Fecha: 2007-09-21 11:46:13

marina escribió:
high school musical mola un montonazo. los mejores son zac efron y vannesa anne judgens.vanessa es super guay y sharpay tambien.sois los mejores!!!! me gustaria que dierais muchas pelis de high school musical. de vuestra querida fan: MARINA OS QUIERO MUXO
Fecha: 2007-09-21 13:44:44

Nerea escribió:
zac efron eres el mejor y estas buenisimo ashley eres la mas wapa de todas!!!vanesa me encanto la peli que hiciste cuando eras pequeña esa en la que tu y dos amigos uno de ellos tartamudo salvais noseque....os quiero wapos..!!!
Fecha: 2007-09-22 05:43:13

carolina diaz marti escribió:
hola me encanta ZAC EFRON esta como un tronco (osea que me lo como enterito) me encantaria ser VANESSA para poder conocer a ZAC y VANESSA eres guapisima.Tengo 11 años. bueno chaooooooo...
Fecha: 2007-09-22 07:29:33

naty escribió:
ta re buena me encanta HSM 1 y 2. zac y a todos los demas los felicito
Fecha: 2007-09-26 10:58:48

Nacho Egea escribió:
troy, gabriela y todos los demas son geniales me encantaria conocerlos a todos yo vivo en argentina (mendoza) soy su mayor fans los re quiero y un besote a todos.
Fecha: 2007-09-26 11:35:16

andres escribió:
high school musical y disney channel son lo maximo!
Fecha: 2008-12-16 06:48:15

v@lentin@ escribió:
hola me llamo valentina tengo 11 años y vivo en chile espero que high school musical sea genial y mas bueno que high school musical 1 y lo voy a ver en la tarde a las 19:00 chao besos :)) xd
Fecha: 2007-09-22 09:45:36

luz escribió:
Fecha: 2007-09-26 12:33:37

miriam escribió:
zac y vanessa os quiero mucho
Fecha: 2007-09-26 13:04:13

MALENA escribió:
Fecha: 2007-09-26 17:34:57

Elina escribió:
todos son buenos les recomiendo la peli!! y obvio a Zac q es muy bueno actuando y es muy lindo vean high school musical 2 por disney chanel!!1
Fecha: 2007-10-01 12:19:01

alejandra escribió:
me gusto HSM jajaja es k vamos vi su peli 2000000 de veces
Fecha: 2007-09-27 10:03:52

sofi escribió:
troy sos hermoso ,la peli esta re buena jaja me gusta mas la 2 q la primera
Fecha: 2007-09-27 10:56:23

PAULA escribió:
Fecha: 2007-09-27 11:08:52

Elen escribió:
Fecha: 2007-09-22 10:46:25

KLEIBER escribió:
Fecha: 2007-09-27 12:26:37

naivy escribió:
troy eres lo maximo porque eres muy guapo a y felisito a todo el elenco muy bonita los quiero muchisimoooo
Fecha: 2007-09-27 13:27:20

ana escribió:
bueno yo creo que aqui nadie me va a leer pero bueno ola me llamo anita tengo 13 años y me encantaria conocer todos los de disneychannel porque son los mejores del mundo buenno nada que espero qe os guste adioosss
Fecha: 2007-09-22 10:46:48

me la pelan todas escribió:
hsm esta mas omenos pero son todos las niñas tontas
Fecha: 2007-09-22 11:07:15

valentina natalia diaz-muñoz pinto escribió:
!me gusta como actuan¡ adamas todos son elegantes bailan muy bien , gabriela es bella y troy juega basquetbol muy bien , troy y gabriela son la pareja perfecta
Fecha: 2007-09-27 16:00:37

victoria escribió:
Hola cuando vienen a Viene Venesuela lo admiro mucho los ador y quiciera catiar co ustedes los quisiera conoser los y los quiero besos para todos los quiero chao
Fecha: 2007-09-22 12:11:29

arianny escribió:
hola gaby como estas me gusta tu programa lo veo siempre me yamo igual q tu pero medicaen arianny
Fecha: 2007-10-01 12:55:10

ornella escribió:
hello como andan bueno zac estasre bueno sos hermoso y nada te amo ooooorrrrrrrrrrrrr!!!!!! sos hermoso sos hermoso guapo!lindo bue chauchis
Fecha: 2007-09-22 12:27:31

arianny escribió:
hola gaby como estas me gusta tu programa lo veo siempre
Fecha: 2007-10-01 12:54:18

estefani escribió:
Fecha: 2007-10-02 13:37:01

andrea escribió:
me gusta mucho y quiero un sidi que me regalen
Fecha: 2007-10-01 12:54:39

Raquel escribió:
ME eNcAnTa hiGH sChOoL muSiCaL. sArPeY erES lA mAS guApA .lSTa. y Mas GUaPa K vAnESa jAjA. ZaC esTas U wENo TKm TkM DE TU mEjoR FaN.
Fecha: 2007-09-22 16:43:44

ELIZABETH escribió:
Fecha: 2007-09-27 16:52:33

nancy escribió:
su pelicula esta depelos ocea quiero ver ya la 2 me emsiono muxo lose pero son los mejores los quiero muxo byeeeeeeeeeeeeeee!
Fecha: 2007-09-27 17:35:06

Raquel escribió:
ME llamo raquel y tengo diez años. me encnata la prte en k vanesaa canta en el laboratorio. xao
Fecha: 2007-09-22 17:08:08

martina ailen vestilleiro escribió:
Fecha: 2007-09-27 17:54:28

amor escribió:
me encanto la pelicula de hig schol musical jac efron es wapisimo pero desde k se corto el pelo puag k orror kedate con el pelo largo bss okm
Fecha: 2007-09-22 18:29:14

paulina escribió:
oly me encanto la pelicula haig school music 2 y corbin blue estuvo supere mino y rico XAU
Fecha: 2007-09-22 18:38:31

brenda asnicar escribió:
hola chicos yo soy brenda daniela asnicar de mendoza bueno yo voy a opinar de la peli nada más porq no tengo tiepo de andar jugando =S pero ya vi la peli y esta ree buena..!! bye bye
Fecha: 2007-09-22 19:39:49

julieta escribió:
les quiero desir que high school musical 2 estubo mas buena que la 1 y me encanta la cancion de eres la musica en mi pero que la cante sharpay besotes para todos
Fecha: 2007-09-27 18:00:40

priscila escribió:
zac etsa guapo?? y bryan ggggggguuuuuuuaaaaaapppppppooooootte aaaaaaaa vanesa chinchosa como siempre y sharpeyn bonita como siempre
Fecha: 2007-09-27 20:14:12

Lismar Carolina escribió:
Hola me encanto la pelicula fue muy emosionante y cantan espectacular les desea mucho exito Lismar Oca.
Fecha: 2007-09-27 20:19:46

Esmeralda escribió:
Troy sos un amor te quiero mucho
Fecha: 2007-09-27 20:56:15

julieta escribió:
hola te extraño grabriela te quiero con toda mi alma te amo... soy nenas no pienses mal jaja bueno me voy porque se me acabaron las palabras bueno chau
Fecha: 2007-09-27 22:10:34

ANNY escribió:
Fecha: 2007-09-22 21:13:46

olatz escribió:
Ami me gusta mucho high school musical. Zack y gabriella son mis faboritos y acen una buema pareja. aqui os dejo mi msn pa q me ableis y se ingles.
Fecha: 2007-09-23 05:01:16

olatz escribió:
Ami me gusta mucho high school musical. Zack y gabriella son mis faboritos y acen una buema pareja. aqui os dejo mi msn pa q me ableis y se ingles.
Fecha: 2007-09-23 05:01:44

Raquel escribió:
MIS favoritos son: sarphey y zac son los mejores del mundo.y si sarpey se pusiese otro color k no fuera tanto el rosa como el azul turkesa le kedaria genial provazlo todos.
Fecha: 2007-09-23 06:08:42

julieta villarreal nardii escribió:
mis favoritos vanessa y zac son lo mas y me encantan como pareja porque ahora estaban juntos!!! antes estaba con ashley!! pero prefiero a zac y nessa... el 22 de septiembre se estreno high school musical 2 estubo muy buena cuando se dieron el beso!!! grite y mi ma casi me pegaa!!! cuando estaba por empezar estaba muy anciosaa!!! las canciones ya me las sabia porque tengo el cd va mas o menoss!! ahora me quiero aprender bn las coreoss!! en mi cole me dicen que soy la loca por high school musicall!!! me huniera gustado ir haberlos en el estadio de river pero no pude !!!! jejej espero que la proximaa ves que vengan los valla a verrr.. nadie puede criticar a los chicos de la peli porque son todos re buena onda por lo que parecen actuan bailan canta bien sosn lo +++!!!! que hay nunca me gusto una peli mas que estaaa!!!!! los quierooo jajaja!!!agregenmee!!!ya se que eso es impossiblee
Fecha: 2007-09-23 08:40:50

kiara escribió:
hola high school musical como estan yo quisiera estar en argentina pero estoy en peru van a venir a peru si vienen yo los espero bay bye me saludas a todos y mas a gabriela y ati
Fecha: 2007-09-23 09:01:59

Cristina garcia bilbao escribió:
Mis favoritos son vanessa y zac , asley yo digo que tiene que venir a dar un concierto a qui buenoooooooooooo
Fecha: 2007-09-23 09:03:27

nathassa escribió:
ma gustaria ser como monic por ue es muy guapa y lista
Fecha: 2007-09-23 09:32:00

ALBA escribió:
Fecha: 2007-09-23 09:36:19

sofia escribió:
quisiera decir q me encanta zac efron ez re lindo .. lo amo y me encanto q zac y vannesa estuviesen de novios en la peli y en la realidad hacen re linda pareja besitos muááá
Fecha: 2007-09-23 10:18:50

Karolina escribió:
jo tia ke fuerrte HSM2!!!Nu se xke pero estoy super ilusionadísima además de ke Zack Efron y Corbin Blue están buenísimos me encanta el caracter de Vanessa y el aspecto y las canciones de Ashley¡Me encantó la de Be good to my!y de Vanessa me pirrian la e "let´s dance" y la de "let´s go" son impresionantess PD:Las voces de Ashley y la de Vanessa hacen muy buena pareja
Fecha: 2007-09-23 12:59:19

MARIA escribió:
Fecha: 2007-09-23 13:48:47

mafe escribió:
la peli debe de ser espectacular me facina los ojos que tiene zak son divinos y mi actriz favorita es vanessa por que su papel es super y ashley eres super besos zak te amo i love you
Fecha: 2007-09-23 13:55:14

mafe escribió:
la peli debe de ser espectacular me facina los ojos que tiene zak son divinos y mi actriz favorita es vanessa por que su papel es super y ashley eres super besos zak te amo i love you
Fecha: 2007-09-23 13:55:37

javiera escribió:
hola soy javiera pero todos me disen javi tengo una hermana gemela y todos ledisen fran chao
Fecha: 2007-09-23 15:20:05

azul escribió:
hola mi nombre es azul y me encanto la peli esta buenisima no me la perdi ayer em disney channel zak es reeeeeeeeeeeee lindo besos!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Fecha: 2007-09-23 15:44:34

deesire escribió:
hola quiero conoser los personajes me gusya ver high scool musical
Fecha: 2007-09-23 16:15:42

grecia escribió:
hola yo soy grecia yo quisiera conocer a los personajes de high scool musical 2, he visto la pelicula parte 2 y me gusto mucho .
Fecha: 2007-09-23 16:23:56

René escribió:
Hola soy rene y tengo 13 años y estoy ansioso por ver high school musical 2. Tengo la primera parte y me encanto. Toda su musica, bailes, son excelentes, hasta ahora tengo el cd original de la primera peli y tambien tengo el karaoke, y el cd de remix, el album de estampas, ahora solo me falta todo lo de la parte 2. No aguanto las ganas de ver la 2da parte Siiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii
Fecha: 2007-09-23 17:55:18

rebeca escribió:
me en canta troy y raian y had yconpania
Fecha: 2007-09-23 23:41:55

IsiTTa escribió:
hola soy isa y me encanta high scool musical tengo muchas ganas de ver la pely de high scool musical 2. Zac porque estas tan tremendo? De una gran admiradora secreta
Fecha: 2007-09-24 09:13:48

valentina escribió:
ashli ¿porque elegiste el personajede mala? o vos no elegiste
Fecha: 2007-09-24 11:35:21

joselin escribió:
son jeniales ustedes grabiela es genial y todos ustedes.
Fecha: 2007-09-24 13:57:02

tiffanny escribió:
yo pienso q high school musical es lo maximo que hay son lo mejor los amo sobre todo a troy
Fecha: 2007-09-24 14:10:07

yuleidi escribió:
es esplendido su jira como van paseando por el mundo yo digo q te quiero raben y a todas las chicas gepardo¡ARRIBA LAS CHICAS GEPARDO!
Fecha: 2007-09-24 15:02:08

rebeca escribió:
me llamo rebeca y tengo 6 años una pregunta: ojala icierais la 3 sera mui diver adios
Fecha: 2007-10-01 14:36:56

cele escribió:
hola me gusta mucho high school musica esta re bueno tengo 6 años y bue se manigar un poco la maquina jeje ee el el email de mi hermano bueno chau suerte
Fecha: 2007-09-24 15:24:29

leonel escribió:
quiero charlar con gabriela tengo 13 años y me gusta HSM
Fecha: 2007-09-24 15:29:16

jasna escribió:
megusto mucho high school musical 2 por eso me gustaria mucho tener los e-mails de ellos
Fecha: 2007-09-24 15:57:37

milit@ escribió:
Quiero conocer az todos los de high school musical esta buenisinoooo me encantaa soy re fan.chauchizz besitos grandes para rodos..mili.
Fecha: 2007-09-24 16:10:13

estefania escribió:
hola me gusta high school musical porque es fantastico y vacanasa sus personajes son sharpay,rayan,gabriella,chad y monic chau
Fecha: 2007-09-24 17:37:21

carmen maria escribió:
el q a mi m gusta es es zacarito m encanta y odio a vanessa es la novia d zacarito y m da celos , ejem , es q es tan linduuuuuuuuuuu... .
Fecha: 2007-10-03 08:54:51

Nayelli escribió:
esta padre la `peli
Fecha: 2007-09-24 17:39:14

nkjcvgew6dsd escribió:
poeque shapar es tan bonita y se cree la mandona.
Fecha: 2007-09-24 17:48:46

jorlenis escribió:
hola me llamo jorlennis y soy una gran admiradora de hsm y obio de sharphey y de troy bolton. Los otros no me encantan mucho pero me gusta mucho su peli esta padre no! adios cicos los quiero mucho.CHAO
Fecha: 2007-09-24 21:49:43

delfina albornoz escribió:
hello! como andan todos los super quiero a todos,y zac efron es un super bombon les mando saludos a todos. los quiero delfi :)
Fecha: 2007-09-24 22:29:34

judith granados aixa escribió:
me gusta mucho TROY tengo sus peliculas,todos sus posters.y creo que sus compañeros y el hacen un gran equipo.
Fecha: 2007-09-25 08:16:32

elena escribió:
pa mi troy esta mu guapo y kiero ver la segunda parte en el estreno pa ver a troy.malaga
Fecha: 2007-09-25 08:53:21

maitane escribió:
me encanta hsm es supr dibrtdo zak estas buenisimo a tod@ l@s k os guste agregadme MSN:
Fecha: 2007-09-25 13:01:10

DANIELA escribió:
hola esto me gsuta mucho y lucas es el papi que quisiera tener y zack para mi es nada mas que una lok jajaj beuno me encanto la 2 fue fabulosa y la cancion bet on it
Fecha: 2007-09-25 16:13:17

KAREN escribió:
Fecha: 2007-09-25 17:40:36

lisbeth escribió:
hola yo digo que zac es muy guapo y tiene unos ojos bonitos y a grabiela que actua muy bien cuidense mucho chauuu
Fecha: 2007-09-25 18:40:20

lisbeth escribió:
hola yo digo que zac es muy guapo y tiene unos ojos bonitos y a grabiela que actua muy bien cuidense mucho chauuu
Fecha: 2007-09-25 18:41:25

sofia escribió:
son todos muy talentosos y admiro a cada uno son los mejores.un beso sofia
Fecha: 2007-09-25 18:56:35

estefani garrido escribió:
encuentro q gabriela es muy bonita y talentosa.
Fecha: 2007-09-25 19:06:53

DANIEL escribió:
estuvo muy bueno la pelicula me dormi hasta las 11pm soy de pachuca de soto hidalgo mexico hasta luego me saludan aaaa troy y a gabriela
Fecha: 2007-10-01 14:03:04

daniela donado escribió:
troy me tienes loca desde que vi la pelicula de high shcool muisic me gusta el papel que haces con gabriella se ven muy lindos ojala y fueran pareja de verdad t.q.m te lo dice daniela troy y gabriella la pareja perfecta
Fecha: 2007-09-25 20:25:04

geraldine escribió:
que es un buen video
Fecha: 2007-09-25 20:55:12

melisa escribió:
zac eres el mas guapo
Fecha: 2007-10-01 13:00:24

yaiza escribió:
me encanta HSMcuando supe k abia 2 me emocione tanto sali de casa para no perdermela. os kiero mucho a todos bsss.yaiza.
Fecha: 2007-10-01 14:54:18

rocio escribió:
te amo zachari alexander efron
Fecha: 2007-10-09 08:52:25

Eva escribió:
troyl eres el mejor te kiero guapo sharpey rayan cantais muy bien y tu vanesa y troyl cantais tambien muy bien os kiero atodos un saludo un fuete abrazo y un beso para todos os kiero a todos mogollon de vuesta amiga eva
Fecha: 2007-10-09 12:27:51

milagros escribió:
me encanta sharpay, grabriela y troy son los mejores. me encantan las dos peliculas
Fecha: 2007-10-01 19:10:31

no t importa escribió:
Fecha: 2007-09-28 11:01:45

eder escribió:
A mi me guasta mucho High Schcool Musical I, seguro que la II tambien me gusta. Mi persinaje favorito es Troy Bolton, por que es muy bueno en baloncesto y yo quiero ser como el.
Fecha: 2007-09-28 11:21:31

marina escribió:
me gusta mucho haigh school musical pero todavia no tengo la 2 y me gustaria mucho tenerla mi personage favorito es sharpay por que es muy guapa un beso para todos los personages de high school musical!!!!
Fecha: 2007-09-28 11:56:26

ainara27 escribió:
me encanta zack
Fecha: 2007-09-28 12:09:53

paloma escribió:
tengo ganas de ver hsm 2 ,e encanto la una es la mejor pelicula que e visto un beso para todos psdt:vanessa eres guapisima!!!!
Fecha: 2007-09-28 12:53:21

mar torrelles giner escribió:
ola am dic mar la pelicula es mol wai akabaras sigen una de las millos pelis kom gris sisplau agrageuma an al mesenger zac banesa asli lucas cordin blu monic sou als mollos una pati dapar meba soc una gtan fan bostra u astimu a tot grasias per le peli!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! mar torrelles giner de tot cor
Fecha: 2007-09-28 13:27:51

barbara escribió:
sharpey eres muy sifrina gabriela eres linda y troy me encanta boy a destruir a sharpey evans
Fecha: 2007-09-28 15:18:58

julia escribió:
me gusta ashley y zac efron y soy mongola jajajajajaja te odio zac
Fecha: 2007-10-02 03:00:03

Julia escribió:
Zac te amo
Fecha: 2007-10-02 06:16:34

Maria escribió:
Hola!!! k tl? chicos me encanto la peli de High school musica 2. Me puse allorar xk gabriella se marcho del club. x me encantaron las des pelis kisiera saber es ms de Zac, Vannessa, Corbin, monique, Ashley y Lucas. Tambien me gustaria k vinieseis a españa de gira a mallorca!!!! A i Corbin me encanta la peli "Salta"
Fecha: 2007-10-02 06:34:53

javiera .j. escribió:
hola me encanto la peli es impresionante hay muchas cansiones :O lo q me encato es la música de gabriela y troy xauuu
Fecha: 2007-09-28 15:55:25

Glorimar escribió:
Ya qiero la tercera pelicula de high school musical. me encanta las actuaciones de todos pero más la de Troy y de Gabriela
Fecha: 2007-09-28 16:57:26

ivanka escribió:
Fecha: 2007-09-28 17:29:24

k@therine escribió:
hola soy katherine en este mismo momento los escucho en el computador queria decirles que troy y sharpay hacen una linda pareja y ryan y gabriela tambien y chad y taylor tambien. bay bay agremenme en su msn mi msn es o a adios cuidense ashley soy tu fans numero1 no paresesde 22 años sino que pareses de unos 16 17 18 . baybay 28de septiembre del 2007 bay bay
Fecha: 2007-09-28 18:41:59

jordan mora mora escribió:
ami me encanta high school mi personaje favorito es troy y gabriella
Fecha: 2007-09-28 19:19:02

annnn escribió:
ashley rocks
Fecha: 2007-10-03 16:31:01

brenda samantha vazquez brito escribió:
hola yo soy fam numero 1 de high school musical y quiero conocer a zac efron y a gabriela osea vanessa y mexico es el mejor lugar aber cuando viene HSM los esperamos atte:brenda samantha vazquez brito
Fecha: 2007-10-02 15:50:18

matias cifuentes escribió:
es ,uy buenno high school musical
Fecha: 2007-10-02 18:00:30

lupita escribió:
hola: los amo y los adoro quisiera saber si quisieran ser mis amigos mandenme un mensaje por mi imel bueno como les digo no creo que este sueño se aga realdad pues soy de zamora michoacan y tengo 8 años de edad espero que me manden un mensaje y que puedan ser mis amigos YO QUIERO SER COMO USTEDES LOS AMO
Fecha: 2007-10-02 18:05:38

welington escribió:
hola soy de republica dominicana y me encanta high school musical y me se todas las canciones de ustedes ademas tengo todas sus peliculas de hsm y me encanta como canta gabriella su boz me hace estar tranquilo. y soy su fan numero 1. adios a se me olvidava que nunca los olvidare y tengo 12 años. adios
Fecha: 2008-12-17 16:51:44

selena escribió:
quiero que aparesca el juego de high school musical 2
Fecha: 2007-10-02 18:51:43

tamara, candela. escribió:
hola chicos como stan me encanta sus peliculas les doy muchos besotes..............
Fecha: 2007-10-02 20:12:56

joan escribió:
asshli te kiero eres mui guapa
Fecha: 2007-09-29 06:15:45

raquel escribió:
zac eres guapisimo y vanesa tambien me encanta high school musical 2 y verles a todos juntos sobre todo a ustesdes 2
Fecha: 2007-09-29 07:07:38

paula escribió:
todos son buenos pero los mejores son: zac y vanesa kis
Fecha: 2007-09-29 07:13:04

raquel escribió:
zac eres guapusimo y vanesa tambien me encanta la peli san juan de la rambla (tenerife) me necantaria verlos un beso y un abrazo
Fecha: 2007-09-29 07:21:34

paula escribió:
vane eres guapisima y no hablo de zac me encanta verles juntos la primera peli esta guapa espero q me guste la segunda kisssss¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡
Fecha: 2007-09-29 07:24:28

nerea escribió:
hola quiero k vosotros perdais y hotel dulce hotel gane hombre ya
Fecha: 2007-09-29 08:43:36

niko escribió:
hola... me encanta high school musical en especial la 2 muy buena y sharpay mmmmmmmmmm..... agarrate la llego a agarrar
Fecha: 2007-09-29 10:58:46

PAULA escribió:
Fecha: 2007-09-29 12:33:15

nikol escribió:
yo creo que debe de salir mas juegos
Fecha: 2007-09-29 13:44:26

camila escribió:
aaaaa me encanta zac efron es demaciado mino es hermoso ya eso pu y hagan mas juegos pu xauuuuuuu
Fecha: 2007-09-29 13:52:43

david escribió:
yopienso que es mui vueno el que ayan puesto estos juegos para poder aprender mas sobre eyos
Fecha: 2007-09-29 14:05:05

Ana escribió:
es la mejor pelicula que e visto porque gabriela es la mejor detodos ellos y tambien troy chad sharpey ellos son muy guapos
Fecha: 2007-10-04 06:47:01

camu escribió:
El ultimo comentario q fue el de david tubo un monton de faltas En fin, esta re-bueno q yo a 1 semana de la pali allan puestu juego. La peli me fasino estubo re-cool bueno les mando un beso la mas mas divina!!!!!camu!¡!¡!¡
Fecha: 2007-09-29 14:15:10

Ana escribió:
es la mejor pelicula que e visto porque gabriela es la mejor detodos ellos y tambien troy chad sharpey ellos son muy guapos
Fecha: 2007-10-04 06:48:06

milagros escribió:
hola me encanta high school musical soy fanatica de todos :Vanesa,Ashlii,Zac y Lucas. los quiero mucho mili¡¡¡¡¡¡¡ =)=)=)=)=)=)=)=)=)=)=)=)
Fecha: 2007-10-04 09:18:16

mabelita escribió:
hola soy la mabvel le kiero felicitar alos xicos de high school musical2 es muy recaleta de buena oka xauu saludos x allá.
Fecha: 2007-09-29 14:49:22

lisbeth escribió:
Zac yo soy tu fans .Y si tu estas enamorado de la Banesa? Y Banesa yo tanbien soy tu fan
Fecha: 2007-09-29 16:02:53

Jordi escribió:
Hola!Soy Jordi y esta noche acabo de ver vuestra pelicula de high school musical 2, es una pasada!Me encanta!Sois jeniales y os esforzais mucho, misueño siempre a sido ser cantante y hacer muchas peliculas, me gusta porque esque me encanta estar en un ecenario y que todo el publico me aplauda, yo soy uno de los mejores cantantes de mi clase, todos los años hacemos n baile y nuestro baile fue elegido el mejor, me tengo que ir a dormir ¡Adios!
Fecha: 2007-09-29 16:09:03

alicia patricia escribió:
hola a todos los que son fans de high school mucical que todos son padres
Fecha: 2007-09-29 16:14:33

angi escribió:
hola chicos son re buenos asiendo peliculas
Fecha: 2007-09-29 16:17:37

Lidia escribió:
high school musical 2 me gusto muxisimo... y las canciones tambien...peor dijeorn k chad y la amiga de gabriela la negrita ellos 2 ivan a salutar alfinal de la peli y no saltaron solo saltaron troy y gabriela pero estubo bn =:P
Fecha: 2007-09-29 16:34:42

vanessa escribió:
zac es super guapo
Fecha: 2007-09-29 16:54:47

maria fernanda escribió:
hooola como estan me encanto hsm2 es lo maximo bueno me encataria tener el msn de algunos de ustedes plis
Fecha: 2007-09-29 17:06:59

jason escribió:
viva high school musical 2 soy su fan
Fecha: 2007-09-29 20:41:03

Bàrbara escribió:
Fecha: 2007-09-29 21:05:49

edson escribió:
hola estoy muy impresionado es algo impresionante se an esmerado mucho para hacer esta peli los felicito mucho mi email es
Fecha: 2007-09-29 22:04:24

Ariadna Picola maso escribió:
Hola me llamo Ariadna soy una de sus fans la verdad Zac eres un bombon.Me a gustado mucho la pelicula High shool musical 2 es impresionante os avra costado mucho asi que os felicito vueno adios.
Fecha: 2007-09-30 03:18:58

Alfonso escribió:
hola me llamo Alfonso y me ha encantado la pelicula de high school musical 2 ademas de que Ryan se volvia bueno es uno de mis favoritos ¡muy buena Lucas!
Fecha: 2007-09-30 03:24:06

aNgIe escribió:
hola bueno... yo keria saber si todavia se puede hacer lo de la encuesta hsm xk en disney channel ponian un programa llamado pregunta a los wildcats pero parece ser que se ha acabado bueno.... que pena
Fecha: 2007-09-30 04:18:49

noe escribió:
hsm es la mejor peli que e bisto a i zac estas cm un tren!!! xd
Fecha: 2007-09-30 04:20:00

marta escribió:
ola a todos zac estas k te sales a ver si me puedes dar tu msn tengo 12 años tQm
Fecha: 2007-09-30 04:23:10

Andrea escribió:
Kisiera que high schoolmusical venga de gira a españa y que venga a zaragoza
Fecha: 2007-09-30 08:12:25

Anonimo escribió:
me a encantado la pelicula high school musical.Es la mejor de todas las que he visto.Zac estas buenisimo eres el mejor actor de todos.No cambies nunca guapo. AUPA HIGH SCHOOL MUSICAL!!!OKM CHICOS
Fecha: 2007-09-30 08:14:29

uxia escribió:
porfa alguien nos puede indicar a que hora ponen hoy dia 30 los wikach.gracias
Fecha: 2007-09-30 08:24:16

laura escribió:
los amo high scool mucicsl
Fecha: 2007-09-30 08:24:59

Adrian meza picazo escribió:
Cuales son vuestros mejores amigos de High Schol Musical 2.
Fecha: 2007-09-30 09:18:14

Marta escribió:
soy la fan nº 1 de high school musical.estoy todo el dia hablando de zac & cia. son los mejores del mundo. ojala fueran de españa, jejej.
Fecha: 2007-09-30 09:48:32

encarni escribió:
me gustaria conoceros porke las peliculas k habeis echo sobre todo la 2 me han encantado.tengo 9 años
Fecha: 2007-09-30 10:12:18

camila y lara escribió:
me encantaria conoserlos la 2 pelicula es re linda
Fecha: 2007-09-30 12:12:29

viki russo escribió:
hola me encanta zachary daviv alexander efron es re lindo es un bonbon jajaja. le mando salu2 a mi amiga solange.chauuu!!!!!
Fecha: 2007-09-30 12:29:07

patricia escribió:
me reencanto la peli high school musical 2 es xulisima lo mejor el beso. aunque devo confesar q le tengoo envidia a gavriela por el beso zac eres riquisimo te amo
Fecha: 2007-09-30 13:50:47

lierni escribió:
Hola vanessa para mi eres la mejor del mundo te kiero y zack estas ke te kagas un beso para los dos
Fecha: 2007-09-30 14:19:14

pilar escribió:
Hola vanessa me encanta como actuas un besazo tkm
Fecha: 2007-09-30 14:22:45

frank escribió:
yo pienso que high school musical es lo mejor que hay
Fecha: 2007-09-30 16:38:23

julieta vega escribió:
ho,a chicas le quiero decir que fui al concierto de argentina de high school musical y ashley con vanessa me dieron su mail mi mail se los escribo para que me agreguen asi les doy el mail de ellas pd/:ah sierto ojo !!! hablan en ingles!!!
Fecha: 2007-10-09 13:13:24

marizell escribió:
yo pienso que high school musical es lo mejor que ahy yo creoo que deverian ponerrrr muchhoooss pero muchos juegos de la peli y puros juegos de compu o de play soy fanatica de high school musical y mi primo tambien
Fecha: 2007-09-30 16:54:08

eliana escribió:
hala a mi me encanta high school musical .........,pero sobre todo me gusta zac efron!:).........¿a ustedes no les gusta ese bombon?
Fecha: 2007-10-04 18:38:43

jorge escribió:
es el mejor cd.acuña coahuila numero 1 yes me gusta mucho..............
Fecha: 2007-09-30 20:03:26

Paz escribió:
Me encanta HSM... Quien sabe donde obtener iconos para msn de HSM???
Fecha: 2007-09-30 20:14:15

lorena escribió:
Hola soy milagros,tengo un primo que salta igual que vos.Me gusta como cantas ,tanbien me gusta com saltas,me gusta la cansion que cantan vos y Rian en la pelicula HIGH SCHOOL MUSICAL 2.
Fecha: 2007-10-04 18:59:06

ana maria palmieri escribió:
son los mejores de hsm 2
Fecha: 2007-10-04 19:57:02

Maria Melissa Alvis Jimenez escribió:
los amo a todos y primcipalmente al papasito de troy.....
Fecha: 2007-10-04 19:57:51

alison escribió:
que ria decir q me gusta mucho high scool musical me en canta
Fecha: 2007-10-04 21:41:12

Meritxell escribió:
la pelicula 1 es muy bonita i la 2 tambien sois todos muy guapos pero los que me gustan mas son: Vannesa, Zac y Asley
Fecha: 2007-10-09 13:56:35

andrea escribió:
me ha gustado la peli i la 2 muxo+
Fecha: 2007-10-05 07:42:27

melani escribió:
a mi me gustaria tener los coreos de gabriela troy de yarpey de brian de chat de taylor
Fecha: 2007-10-05 13:45:07

LuLy escribió:
vanessa sos lo +
Fecha: 2007-10-13 12:37:21

camila escribió:
vueno yo kiero desir k adoro a hsm y hsm2 y amo en espesial a zack efron (troy bolton)para las ke no lo saben chaoooooo..... te amotroy bolton soy el numero 1
Fecha: 2007-10-12 17:15:53

juncal escribió:
olaaaaaaaa xicas sosis lo megor troi eres lo megor gabriela te sale si la pelide salta la me gor hms 3 ba aser tela
Fecha: 2007-10-11 12:48:56

camila escribió:
Fecha: 2007-10-11 13:22:08

baltasar escribió:
ola por favor agregadme,soi el fan n1 soy
Fecha: 2007-10-06 03:56:20

CLAUDIA escribió:
Fecha: 2007-10-06 04:18:42

Irune escribió:
zac efon i love you these very handsome in high school musical 2 you must come to bilbao plis lady's man I want much to you kisses for you Irune kisses
Fecha: 2007-10-06 05:04:31

Ricardo escribió:
soy fan de troy
Fecha: 2007-10-10 13:54:26

Raquel escribió:
high school musical es lo mejor!!!!!1111
Fecha: 2007-10-06 09:19:08

laura escribió:
high school musical me encanta
Fecha: 2007-10-06 09:45:15

lAuRa escribió:
high school musical 2 es una pasada soys los mejores soi una fans vuestra bueno adios
Fecha: 2007-10-06 09:48:22

sofia escribió:
holos amo a los chicos de ustedes
Fecha: 2007-10-10 14:47:25

KIMBERLY escribió:
Fecha: 2007-10-06 10:39:57

carmisia i delisia escribió:
la pelicula high school musical 2 es un lio, ma agradat mes la primera peli
Fecha: 2007-10-06 11:38:36

maria jose escribió:
hello yo soy de chile (linares) y me encanta high school musical 2 ..........
Fecha: 2007-10-06 12:06:57

maria paula escribió:
hola como estan espero que bien quiero saber porqueno aparece el juego que muestran en la tv en esta pagina mi nombre es maria paula acuerdecen a y mi apellido bustamante vargas ramires escovar vivo en envigado alcala
Fecha: 2007-10-06 12:46:10

axel k-po escribió:
hola soy de argentina (mendoza)nose no aparece ningun juego de high school msical 2 espero salga alguno
Fecha: 2007-10-06 13:24:06

camila escribió:
olaaa me gusta high school musical 2 es muy bueno... soy de chile (lo barne) wenu me gusta ashly weno xauzzzzz y un gran beso para todos
Fecha: 2007-10-06 14:25:49

aline escribió:
olaaa... yo soy de chile(lo barnechea) y me gusta mucho high school musical... y sobre todo grabriela(vanesa)y troy(zac) bueno xau y de verian poner canciones de high school musical 2 chao
Fecha: 2007-10-06 14:29:43

MICAELA escribió:
Fecha: 2007-10-06 14:30:22

paula escribió:
Fecha: 2007-10-06 15:04:14

natalia escribió:
si tan solo pudieran comoseme los embitaria a mi casa a comer pero no asies el destino PEROOOO TENGO SUS PELICULA YO ME LLAMO NATALIA
Fecha: 2007-10-06 15:45:59

naomi escribió:
high school musical 2 es bkn es tu bo bueno me encanta cuand ban aser mas pelicualsmen encanta es super bkn xauuuuuuuuuuuuuuuuuuuu espero que les aballa super bien
Fecha: 2007-10-06 17:43:50

makarena paola escribió:
son baka y me gusta el personaje de troy y gabriela
Fecha: 2007-10-06 19:01:50

mamen escribió:
soy un superfan de hight shool musical me se todas vuestras canciones y tengo todos los discos y me han encantado las 2 películas sobretodo porque en la 2 pelicula vannesa y zac no se dieron el beso hasta el final
Fecha: 2007-10-07 02:42:46

rocio escribió:
la pelicula es genial
Fecha: 2007-10-07 05:37:20

maria escribió:
la me encanto soy superfan de zac y vanesa
Fecha: 2007-10-07 05:39:51

maria escribió:
la pelicula me encanto soy superfan de zac y vanesa
Fecha: 2007-10-07 05:40:47

GABRIELA escribió:
Fecha: 2007-10-07 08:22:03

celia escribió:
me encanto la peli mas cuando todos cantaron juntos muchos cariños y besos a zac,ashly,vannesa y a todos los demas
Fecha: 2007-10-07 10:01:20

nuria escribió:
hola vanesa i todos soy vuertro mayor fan
Fecha: 2007-10-07 12:09:44

nuria escribió:
Zac estas como un queso y Vannesa eres guapisima
Fecha: 2007-10-07 13:20:55

nadia escribió:
me encant high school musical 2 esta re buena la pelicula y no me gusta sharpey xq es muy mala con gabriella y mis personajes faoritos son troy y gabriella.chau besos
Fecha: 2007-10-12 16:25:51

paulina alejandra delgado barria escribió:
sharpay eres la mejor con toy
Fecha: 2007-10-10 17:16:17

consuelo escribió:
troy te amo eres super lindo ,grabrilla tambien eres linda chauu
Fecha: 2007-10-10 17:31:46

melani escribió:
me gustaria conoser a los chicos de high school mucical a Gabriela troy sharpey
Fecha: 2007-10-07 15:13:13

andrea escribió:
eheee ehe bkn sta paginaa jajaja tan bkn weno... eso les recomiendo sta pagina
Fecha: 2007-10-07 15:43:46

bueno lo primero es q vanesa y zac asen una bonita pareja y ojala se agan novios .la pelicula esta bacan esta linda. ojala vinieran para nv chimbote . zac me muero x conoserte te amo un besote ESTEISI
Fecha: 2007-10-07 18:43:49

AGUSTIN . escribió:
Fecha: 2007-10-07 19:19:43

elliot escribió:
q vanessa hudgens es uan mamacita y ta bien rica y q pronto venga a peru a cantar y q vanessa salga en bikinni cantando de dia
Fecha: 2007-10-07 21:28:02

mily escribió:
holisss!!! bue lo q keria dcir es q m muero x troi y q es super lindo!!!!
Fecha: 2007-10-12 16:26:13

antonella alvarez gardin escribió:
los de high shool musical son super fabulosos y son estupendos gabriela eres muy linda
Fecha: 2007-10-10 18:26:38

camilo sosa escribió:
son la mejor banda del mundo y gracias por ser tan cheebres
Fecha: 2007-10-10 19:58:48

yaiza escribió:
hola vannesa me encanta la peli higt shool musical 2 sobre todo tu porque es muy bonito cuand os tiras al aqua
Fecha: 2007-10-11 07:57:02

yaiza escribió:
hola vannesa me encanta la peli higt shool musical 2 sobre todo tu porque es muy bonito cuand os tiras al aqua
Fecha: 2007-10-11 07:57:25

lucero damariz escribió:
hola!!!!!!!! atodos ps saben me gusta muxo troy y vanessa k linda pareja hacen me gustaria tener sus correos y asi conversar ps soy peruana de madre de dios y tengo 14 añitos mi correo es plis denme su correo si mi cel pa todods es 0829748155 llamemme
Fecha: 2007-10-08 10:30:12

agustina escribió:
hola como andan los quiero mucho y ashley sos lo + de la peli igual que todos
Fecha: 2007-10-11 10:37:34

luisna escribió:
me encanta high scool musical 2 me encantaria ser como ustedes me llamo luisina medici y tengo 6 años los quiero un beso
Fecha: 2007-10-08 15:10:08

Fecha: 2007-10-11 13:27:33

sofia escribió:
hello como le van a todos!!! yo estoy re bien besos le aso mi email besos sofia besitos
Fecha: 2007-10-13 15:14:39

Fecha: 2007-10-11 13:32:10

Fecha: 2007-10-11 13:37:14

chicos son los mejores qe conoci los quiero muchisimo la peli de high school musical 1 y 2 me encantaron las vi 40 veses maso menos ChAu LoS qUiErO mUcHo
Fecha: 2007-10-11 13:45:17

camila carlos escribió:
hola chicos me encanto la peli
Fecha: 2007-10-11 12:38:55

paula escribió:
chicos q buena pelicula te amo troy eres re lindo tqm
Fecha: 2007-10-08 21:27:11

chicos los re quiero camila torres
Fecha: 2007-10-11 15:55:10

Fecha: 2007-10-11 15:58:09

karen escribió:
hay no manches son un buen de personas hay pos ami me cai q ni siquiera la leen ps queria ser mi comentario pero para q eee y digo chicos de hsm son los mejores son mis idolos "mi suño es hacra algo de lo q hicieron ustedes" y tambien unos de mis sueños es conocerlos me encanta
Fecha: 2007-10-12 17:33:46

estefania callejas zuñiga escribió:
Fecha: 2007-10-12 17:54:46

michelle escribió:
son lo mejor
Fecha: 2007-10-12 18:43:05

maryori escribió:
es la mejor pelicula q visto y adoro a Ashley Tisdale)es muy regia
Fecha: 2007-10-13 15:15:21

GOZ escribió:
Fecha: 2007-10-11 16:44:04

MAFE escribió:
me pareze que high school musical es lo mejor
Fecha: 2007-10-12 21:05:26

emily escribió:
me encanta high scool musical muero por zac efron es un bombom y vanesa es re linda
Fecha: 2007-10-11 18:09:39

andea escribió:
me ha encatado la peli,Zac estas buenisimo i gabriella y shapey son guapisimas
Fecha: 2007-10-12 06:10:14

claire escribió:
me encanta la peli y zac es guapisimo y gabriella es listisima
Fecha: 2007-10-12 09:50:27

Sandra escribió:
Ami tambien me gusto mucho high school musical 2.Zac estaba wapísimo ojalá ke agan high school musical 3. La estoy deseando ver.TODOS ESTABAN WAPOS HASTA SALIA HANNA MONTANA EN LA PARTE DE EL FINAL.
Fecha: 2007-10-12 10:57:40

Sandra escribió:
Ami tambien me gusto mucho high school musical 2.Zac estaba wapísimo ojalá ke agan high school musical 3. La estoy deseando ver.TODOS ESTABAN WAPOS HASTA SALIA HANNA MONTANA EN LA PARTE DE EL FINAL.
Fecha: 2007-10-12 10:58:01

claudiaa escribió:
ola! m'encanta hifg school musical !!! wapos!
Fecha: 2007-10-13 07:10:34

maria escribió:
me gusto mucho la pelicula y tambien les queria decir q yo me acoste con vanessa y ella hace el amor muy rico cuando te mete el pene portatatil q tiene en su cartera bye
Fecha: 2007-10-12 11:42:54

ionelopez escribió:
zac wapo tkm stas mas wapo en la peli uno gabriella wapixima eres la mjor tkmm os rekomindo a toos la peliii!!!
Fecha: 2007-10-13 08:06:13

alba escribió:
me encanta high school musical 1 pero cuando vi high school musical2 me gusto muchisimo mas es mucho mas dibertida y las canciones tambien son mas chulas adios.
Fecha: 2007-10-13 09:26:43

DULCE escribió:
Fecha: 2007-10-13 15:48:29

jorge escribió:
me encantaron buestras 2 peliculas sois los mejores
Fecha: 2007-10-12 13:23:09

AlEjAnDrA escribió:
nada mas les quiero decir que soy fans de high scool musical me encanta ,todos cantan bonito bueno bye..............
Fecha: 2007-10-16 09:55:58

sandra escribió:
hola que tal me gusta mucho buestra serie me gustaria beros a todos
Fecha: 2007-10-16 10:55:59

valeria escribió:
me gusta high school musical mi personaje favorito es la gabriela yo espero ver pronto la pelicula numero 2 que han grabado espro que sea muy buena tambien quiero decirles que la pelicula numeroa 1 es muy buena bueno ese fue mi comentari xauuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu besitos
Fecha: 2007-10-13 15:58:34

juliana escribió:
zac eres un papacito por los ojos y vanesa canta super marabiyoso espero que me enseñes a cantar como tu y saludos atodos los de hsm chao
Fecha: 2007-10-13 16:44:39

javiera escribió:
me encanta zac efron es muy mino y la vanessa es muy bonito bueno xau
Fecha: 2007-10-13 17:25:23

emily escribió:
me encanta high school musical mis personajes favoritos son zac y vannessa me encantaria conocer a zac en persona lo re amo
Fecha: 2007-10-13 17:46:32

casandra escribió:
vanesa es re linda y canta hermoso me re gusto high school musical 2
Fecha: 2007-10-13 17:49:33

solange sofia escribió:
me encanta high school musical 2 es lo maximo todos los personajes son hermosos pero en especial zac , zac estas buenisimo eres lo maximo!!!!!!!!! te adoro ah se me olvidaba este e mi e-mail te adoroooo
Fecha: 2007-10-13 17:50:26

leyla escribió:
hola a todos a mi me gusta ver high shool musica el 2 me encanta okbye saludos
Fecha: 2007-10-13 18:42:20

anapaula escribió:
holaaa como andannn losde higschool musical2 quieroo cono serlosssssssss :)
Fecha: 2007-10-16 11:59:03

jesssi jazmin andrade ampuero escribió:
oye troy eres un papasito y sharpey eres muy bonita y gabriele eres una fea y mostra
Fecha: 2007-10-13 18:45:24

jesssi jazmin andrade ampuero escribió:
oye troy eres un papasito y sharpey eres muy bonita y gabriele eres una fea y mostra
Fecha: 2007-10-13 18:45:30

paola escribió:
hsm eres genial vanessa te amo zac ashley lucas monique corbin los adoro
Fecha: 2007-10-13 20:38:47

giovanna uribe escribió:
vanessa eres lo maximo,zack te adoro,ashley eres muy guapa,rayan te adoro
Fecha: 2007-10-13 20:46:25

Robeto Carlos escribió:
ola soy roberto si me estan biendo no sabre ingles pero me encanta high school musical 2 porfa porfa porfa pongan el msn si lo saben de todos sobre todo de
Fecha: 2007-10-16 12:19:08

carlos escribió:
hola es super bkn no se pierdan high school musical 2 la vi y me encanto mi msn es agregenme ay charlamos bayyyyyy
Fecha: 2007-10-13 22:39:37

carolina escribió:
hola esta re buena esa foto de high scull misical jaja me tengo que ir caro xb
Fecha: 2007-10-14 00:41:00

valeria alejandra escribió:
hola amo la peli de HSM
Fecha: 2007-10-14 10:40:28

valentina elyzabeth escribió:
me ree gusta la peli hsm 2 esta buenisima a keru mandar un saludo a alejandro me tengo q ir chaoooo valyta
Fecha: 2007-10-14 11:57:57

andrea perez escribió:
me ha encantado la pelicula esta buenasa ojala q high school music 3 este mas buena
Fecha: 2007-10-14 12:58:20

sofi escribió:
vanesa y zack cantais hermoso haceis una buena pareja jaja
Fecha: 2007-10-14 13:37:57

sofia escribió:
es la peli mas buena que alla visto la 1 y la 2 estan espectaculares me facinan todas las pelis y me encantaria conocer en persona a yarprey , gabriela , troy y brian soy fanatica de ustedes espero que me contesten un beso chau
Fecha: 2007-10-14 13:39:23

ulia escribió:
mola mogollón aunque si en la peli cantan tambien dveria de aberun juego
Fecha: 2007-10-14 14:00:55

valerita escribió:
amo ash y zac los dos sssson novios
Fecha: 2007-10-17 16:52:12

flopy escribió:
aguante high school musical
Fecha: 2007-10-17 18:45:59

andreita escribió:
hola high school musical ustedes son lo me jo pero mas me gusta zac efron y a vanessa anne ustedes soy mis fanaticos y un poco a sarpay me encantas zac eres el hombre de mis sueños igual a vane quisiera que ella sea mi unica hermana igual a zac quisiera que sean mis hermanos zac yo ya e soñado muchisimo con tigo e igual con vane y mi sueño qiero que sea que ustedes sean mis hermanos bueno ya me tengo que ir te mando muchos saludos zac e igual que a ti vane los quiero mucho a los dos los amo bbbbbbyyyyeeeeeeeee se cuidan mucho atte andy te quiero zac
Fecha: 2007-10-16 12:26:21

leticia escribió:
deben ponerjuegos de high school musical porq es vacan y de ben porner igual q dijo nallely
Fecha: 2007-10-14 14:07:41

leticia escribió:
deben poner el juego mas divertido de high......... gracias
Fecha: 2007-10-14 14:10:21

leticia escribió:
hola soy leticia quiro q ponganjuegos de high........... 2 porfa si investigan les doy mi correo
Fecha: 2007-10-14 14:22:59

leticia escribió:
zac,vanessa,ashley,ryan,corbiny monique los adoro
Fecha: 2007-10-14 14:48:26

Sstefani escribió:
holaa!!! mi pareja preferida era: zak y vanessa, pero desde que vanessa se saco fotos desnuda, parece una desubicada, asique la pareja de ahora es: zak y ashley, mis idolos son todoss!!
Fecha: 2007-10-14 14:53:23

ampa! escribió:
hola!! me encanto high school musical 2!!está re copada...obvio que las canciones tambien... soy de Rauch y tengo 10 años... chau...ampa!
Fecha: 2007-10-20 08:22:00

GLORIA MARIA escribió:
Fecha: 2007-10-16 12:37:14

camila escribió:
hola les queria decir que high school musical 2 es super buena y troy bolton es un bonbon y esos ojos que tiene aaaaa qu erico y la sharpay me gusta mucho es muy bonita y tambien es bonita la gabriela cantan muy bonito todos
Fecha: 2007-10-16 12:46:25

Fecha: 2007-10-14 16:23:25

chiara escribió:
hola!!!son los mejores troy y vanesa son los mas lindos chauuu besos
Fecha: 2007-10-14 17:12:07

nathy***** escribió:
hola!!!! me llamo nathalia y soy fan numero 1 de high school musical 2 por favor mandenme fotos de hsm a mi correo que es
Fecha: 2007-10-14 17:26:54

trini y la corty escribió:
hola amigos!!nos encanta HSM esta re-copa,zac y corbin son re-lindos ... le mandamos un beso a todo 5º año de la escuela Inmaculada Concepcion de Rauch en especial a mica y a jose... chau...corty y trini
Fecha: 2007-10-20 08:29:24

samantha escribió:
ola!!!!me llamo samantha y soy la fan 1 de high scool musical y quiero mucho a troy mandeme fotos de hsm ami correo que es fecha:2007-10 14 :9 21
Fecha: 2007-10-14 21:21:32

Johana Giselle escribió:
me gusto la pelicula de high school 2 y me gusta como cantan gabrila troy sharpey rayan teylor y chad siempre que pasan la peli la veo gracias.
Fecha: 2007-10-15 12:13:18

marysol escribió:
heyyyy soy marysol y quiero decir que zac ashley lucas
Fecha: 2007-10-17 12:46:52

camila escribió:
ya se que todos lo saben pero troy es un bombon es muy lindo tengo todas las fotos de el tomen mi correo :troy
Fecha: 2007-10-15 13:12:54

ALIXON MARIA escribió:
Fecha: 2007-10-15 13:22:50

aracely escribió:
kisiere saber el msn de troy,gabriela,rayan....etc espero q lean mi mensaje los kiero
Fecha: 2007-10-15 15:30:01

rocio escribió:
hola solo quiero decir que saoy una gran fanaticade high school musical si quieren platicar conmigo escribanme a los espero bye fanaticos de high school musical
Fecha: 2007-10-15 16:09:36

moni-k escribió:
es lo mas espectacular de mi vida y me gustaria ser la gabriela para estar con troy por q lo amo mucho con todo mi corazon chao los quiero a todooos
Fecha: 2007-10-15 17:16:04

mariana escribió:
soy gey q ago vanesa me yamo eric pero digo mas bien me gusta el nombre de mariana 17 años
Fecha: 2007-10-17 16:34:32

marisol escribió:
hola soy marisol soy muy chilos todos me encantas troy yo quisiera ser gabriela esta muy bonita y muy simpatica bueno bye lo quiero se cuidan
Fecha: 2007-10-15 23:51:28

jessica alejandra escribió:
yo creo qe hi school musicales lo maximo y qe vanesa esta muy guapa y zac se va a qedar con vanesa
Fecha: 2007-10-21 14:04:24

brenda cantero escribió:
chicos ¿como andan?
Fecha: 2007-10-20 10:24:11

janeth lopez aguirre escribió:
me encanta high eschol musical porque tienen muy buenos actores
Fecha: 2007-10-21 15:03:37

anonim@ escribió:
¡¡¡¡¡¡¡¡¡como molo la peli¡¡¡¡¡¡¡¡¡¡¡ ¡¡¡¡¡¡¡¡¡¡¡¡estuvo chulisima
Fecha: 2007-10-20 11:36:04

ana mateo escribió:
hola me llamo ana tengo 25 año de edad le quiero decirlea zac y a vannessa que son una buenas parejas quieron deciar que vengan a san juan de la maguana rep.dominicana. se despide ana
Fecha: 2007-10-18 16:42:26

carlos escribió:
hola me llamo carlos poma castillo ronaldo y que troy y gabriela son buenos amigos y parejas yo les quiero decir que vengan al peru y que tengan un concierto en av.canta callao 3 cuadras para alfondo en san martin de porres al frente del mercado mivisu va a ver un local donde adentro esta todo esta pintado de high school musical pero ay tierra vengan con zapatillas porque se van a ensuciar y como yo vivo alfrente les voy a ayudar en poner toas las cosas y ami me van a dar entradas dobles no porque les quiero ver en vivo a high school musical fecha:2007-10-18 16:
Fecha: 2007-10-18 17:44:34

roxana escribió:
Fecha: 2007-10-20 12:41:20

ANONIMO escribió:
Fecha: 2007-10-20 13:05:29

agustina escribió:
zac sos el mejor te amo un monton me recontra gustas la primera ves que vi la peli ya me avia enamorado cuando cantaste con vanessa me emocione porque me encanto la cancion
Fecha: 2007-10-20 13:58:37

emily espinosa fan numero 1 escribió:
quiero proximamente high school musical 3 y quiero fekicitarlos a todos por que son los mejores los quiero mucho son de lo mejor........
Fecha: 2007-10-18 20:19:41

RAmiro escribió:
holas aca le bajo high cool musical 2
Fecha: 2007-10-18 22:31:13

sofia escribió:
esta super duper copado son unos genios
Fecha: 2007-10-20 15:03:34

mayra escribió:
zacari david alexis elfron sos un bonbonn y ojala que engan al gran rex chau soy la primera fa
Fecha: 2007-10-20 15:47:21

alba escribió:
que me ha gustado mucho la pelicula
Fecha: 2007-10-19 10:26:44

melanie escribió:
los amo soy su fan numero 1 son geniales................
Fecha: 2007-10-19 15:20:07

maria jose mejia escribió:
Fecha: 2007-10-19 16:27:10

lodovico y fernanda escribió:
ola a mi me encanta hagh scool musical 2 para min son los mejores besos
Fecha: 2007-10-24 15:02:41

caro escribió:
hola!! me encanta h.s.m2 es lo más especialmente las canciones "Por mi camino iré" y "Eres la música en mi" es pero q' alla una 3º peli lo adoro son lo major los re admiro */*byeeeeeee*/*
Fecha: 2007-10-20 17:15:30

jhon jadher escribió:
me llamo jhon me gusto mucho la pelicula sobre todo las cansions com what time is it y ebriday los admiro mucho espero con ancis que ustedes hagan high schhol musical 3 chao
Fecha: 2007-10-20 17:15:50

florencia escribió:
holis soy flor me encanta hsm 1 y 2 por lo q asen bailan cantan esta re bueno bueno besos
Fecha: 2007-10-21 15:49:18

LESSLY escribió:
Fecha: 2007-10-20 17:46:19

SOFIA escribió:
Fecha: 2007-10-20 18:26:06

michelle escribió:
troy me pareses lo mejor eres el mas guapo kisiera conoserte a ti y a chad
Fecha: 2007-10-20 18:45:09

Patricia Rivero Rodriguez escribió:
hola me encanta high school musical 2 y sobre todo ashli y en los disney channel games bueno perdon pero no queria k ganara el equipo rojo,bueno si pero no tanto.queria k ganara el equipo verde.porque esta mi zack zack efron no si dilan sprouse es el mejor bueno yo creo k tu tienes 12 o 13 años estas en la mejor edad te quiero mucho.aver si hacen alguna pelicula y la ponen en el cine bueno adios muack un beso para todos y uno grande para mi dylan.firmado: patricia
Fecha: 2007-10-20 06:48:15

loreto y javiera escribió:
holi son super buenos sigan asi
Fecha: 2007-10-20 20:29:26

AIME escribió:
Fecha: 2007-10-24 18:05:29

kimberly escribió:
hola me llamo kimberly solo queria decirles que me encanta troy bolton el es un recapasito me encanta como baila y como canta me gusto mucho high scool musical 2 gabriela ten cuidado por que te voy a robar a ese lindo muchacho a troy
Fecha: 2007-10-21 16:33:37

agustina ricci escribió:
ami me encanta high school musical 2 el uno + o - pe ro me gustan mucho el personaje de gabriella me encanta yo la agustinitahhh
Fecha: 2007-10-21 16:34:20

daniela cid escribió:
bueno, sigan asi me gusto la pelicula de high school musical 2 y sobre todo ashli y en los disney channel games weno xao saludos para ustedes chicos yyyy me encanta dilan sprouse
Fecha: 2007-10-21 01:05:03

fabrizio novoa escribió:
me encanta high school musicaly2 me fasina esa pelicula zac dame tu msm porfabor y de los demas
Fecha: 2007-10-24 17:10:21

rosi escribió:
bueno,sigan asi me gusto la pelicula de high school musical2 y a ver cuando estrenan high school musical 3 y high school musical 4.
Fecha: 2007-10-21 05:00:35

estefany escribió:
Fecha: 2007-10-21 16:44:15

gabriela de argentina escribió:
me encanta las coreos de high school musical 2 zac y vanesa son lo mas los quiero mucho. me encanta todo el elenco de hihg school musical los quiero gabriela
Fecha: 2007-10-21 16:55:10

mayra escribió:
hola troy sos re lindo y me gustaria conoserte te amo soy de 25 de mayo
Fecha: 2007-10-21 17:47:40

alba escribió:
me encanta high school musical es mi peli preferida
Fecha: 2007-10-21 11:08:14

sarah escribió:
es muy buena la pelicula de hidh school musical 2 pero la q no me gusta es vanesa es la peor bueno pos era eso adios y sigan asi todos
Fecha: 2007-10-21 11:26:58

maria laura escribió:
me gusta high school musical, los chavos estan guapisimos. las muchachas estan bellas. pero gabriela es un poco presumida. pero igual me agrada y a sharpey es una chica muy linda a zack, corbin y brian son muy guapos. los quiero
Fecha: 2007-10-21 12:13:20

nina escribió:
zac eres genial en la peli y eres guapisimo a mis amigas y a mi nos pareces qe estas bueno cuando leas esto me puedes enviar tu messenger besos nina
Fecha: 2007-10-22 07:00:05

beatriz escribió:
ola como estas te quiero un moton soy tu acmiradora bay
Fecha: 2007-10-21 20:57:06

Gabriela escribió:
ami me encanta high achool musical 1 y 2 por su musica , bailes , etc. La que creo de las chicas que actuan bien son Gabriela y Sharpay . De los chicos creo que Troy , Ryan y Chad . ESPERO QUE LES GUSTA TANBIÉN HIGH SCHOOL MUSICAL 1 Y 2
Fecha: 2007-10-21 12:44:41

nina escribió:
ola me a encantado la peli sobretodo a zac qe salia muy guapo zac cuando leas esto me puedes enviar una foto tuya firmada a sevilla c/bami n-26 portal 2 2-A la provincia y localidad sevilla esperare con mucho interes tu foto besitos nina muchas gracias a y un beso a todos tu compañeros de la peli RECUERDOS NINA MUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Fecha: 2007-10-22 07:08:25

NINA escribió:
Fecha: 2007-10-22 07:11:08

madeleyne escribió:
Fecha: 2007-10-22 15:16:28

m li sa escribió:
holaaaaaaaaa me gusta mucho haig shool musical
Fecha: 2007-10-25 12:28:34

laura medina olivares escribió:
hola me llamo laura me gustantodos los personajes pero mi preferido es troy me gusta mucho. Me gusto la peli 1y2 por favor resnondanme
Fecha: 2007-10-25 14:21:48

ana escribió:
soy gabriela y nadie me la puede quitar,high school musical 2 es lo mejor, la caña, la.... etc.
Fecha: 2007-10-25 14:27:30

ANTONELA escribió:
Fecha: 2007-10-26 14:42:25

ruth escribió:
me llamo ruth y me gustan sus canciones los quiero bye
Fecha: 2007-10-25 17:46:16

lucrecia escribió:
hola me llamo lucrecia serena trinidad biondi, y me gustaria saber cual va a aser la siguiente guabriela,y me encanta la serie
Fecha: 2007-10-26 15:37:06

lucia escribió:
zac t amo vanessa sos dibina me encanto hsm y hsm 2!!!!!
Fecha: 2007-10-25 19:40:37

LAURA escribió:
hola high school musical 2 pos esta bien padre la pelicula eee y pos todos los de high school musical posngamen en su msn y porfis es lo que mas deseo que me pongan en su msn sle pos me voi ya saben que los quiero un friego sobre todo a ti troy asi kues me voy los amo
Fecha: 2007-10-22 17:54:49

DANIELA escribió:
hola hsm2 como estan sabian que soy una fans numero 1 de ustedes y me encanto mucho la peli sigan asi chaoooooo a y zac esta mas papasito
Fecha: 2007-10-22 21:30:08

roila escribió:
creo q zac es el mas lindo y guapo de todos y vanessa el la mas linda de todas hacen la pareja perfecta. ¡te amooooo!
Fecha: 2007-10-23 09:54:09

raquel escribió:
hola megusta ver hotel dulce hatel por zack y cody
Fecha: 2007-10-23 10:42:05

samantha escribió:
bueno yo slo quiero desir q la segunda peli estubo chida y que zac efron esta bien chulo para comer vivo y ami amigo diego le gusta vanessa aun q sealla fotografiado denudas bueno bye i love you
Fecha: 2007-10-23 11:55:15

JOSE LARRY escribió:
hola soy jose larry hasta ahorita no eh podido jugar los juegos de hig scool musical 2 y kiero ke me digan tonde puedo encontrar los juegos porke estoy hancioso por jugar byebye bye un saludo para mi mejor amiga alexandra
Fecha: 2007-10-23 13:50:34

cloe escribió:
la pelicula es muy divertida bueno super gapisima i los juegos tambien
Fecha: 2007-10-23 14:05:30

Alejandra escribió:
high school musical 2 fue muy linda... y es!!!! trata una tematica muy interesante el amor.... excelente work boys
Fecha: 2007-10-23 14:06:07

MARIA escribió:
me encanta hihg school musical 2 y sobretodo zac me encanta el basket y banessa me cae ssuper bien muchos besos
Fecha: 2007-10-26 11:18:03

vero escribió:
me guta muxo las series d disney channl y soy una gran fan d ZACK EFRON. xau os kero muxo a tos
Fecha: 2007-10-26 11:57:26

camila escribió:
oli me llamo camila y soi de chile me encanta high school musical la 1 y la 2 chaooooooooooooooooooooooooooooo saludos a todosssssss
Fecha: 2007-10-26 16:05:08

amy pazmiño escribió:
hola como estan yo soy tu admiradora numero uno
Fecha: 2007-10-26 19:03:46

julieth escribió:
quiero que sepa que en mi vida no he visto algo mejor papasito me encantaa diera la vida por conocerte personalmente pero soñar no custa nada ehh y si puedes darme un numero de movil.. o venir a españa ..
Fecha: 2007-10-26 13:16:29

lannis cabrera escribió:
hola somos abrahan y angel nos gusta mucho sus pelicula mi hermano angel es muy fanatico a ustedes y se sabe todas las canciones en ingles y solo tiene 6 años
Fecha: 2007-10-26 21:21:43

Fausto Martinez escribió:
quiero se amigos de high school musical 2 conectense con migo a las 6:00 please yes
Fecha: 2007-11-01 09:17:59

zaira esrefania escribió:
Soy fans de high schoolmusical pro Banesa la riega ¡encuerarse para alguien!como queno ahora la van a remplasarte con la de chita girs Banesa no lo aprobechaste lla ves lo que pasa ahora millones de fans estan depcionados por tu error.Espero que no te despidan pero lo que se ase lla no se desase
Fecha: 2007-10-23 18:53:53

diego escribió:
me ancanta high school musical 1 y 2 es genial yo soy su fan numero 1 porque me se todas las canciones yo quiero que troy bolton me mande su msm al mio el mio es
Fecha: 2007-10-23 23:13:27

raquel escribió:
a mi me encanta high school musical 2 y quieron k den 3 parte
Fecha: 2007-10-24 03:39:20

rocio escribió:
ola!!!! me enkanta igh scool musical tanto la primreo komo la segunda soy la fan numero 1 d zac jejeje k wapo k es el tio!!! tkmmm bueno bss a todas las fans d zac
Fecha: 2007-10-24 07:59:25

LAURA escribió:
Fecha: 2007-10-24 08:34:53

joyce camila rada torres escribió:
zac cuando vienes a barranquilla yo quiero consegir tu mesinller
Fecha: 2007-10-24 09:13:57

lorena escribió:
Fecha: 2007-10-24 10:07:23

Pretty escribió:
Hello...fue buenisima la 2 peli pero Zac tenia la voz de pito pero eres mu guapo chaval aunque pa mi Chad es muchisimo mas wuapo excepto los pelos pero eso se arregla,sigue asi wuapiiiiiiiiiiiiiiiiisimo
Fecha: 2007-10-28 09:31:26

laura escribió:
troy es guapisimo
Fecha: 2007-10-24 10:32:09

julian escribió:
eta buena la fto...... we:) rrr copa... we :) :) =: =:
Fecha: 2007-10-24 11:41:14

`paulita escribió:
hello les queria decir que me encanta ashley tisdale yo la fui a ver a river y nos hicimos amigas y me firmo un autografo chau
Fecha: 2007-10-24 12:07:08

ammi natalia almonacid escribió:
hola me llamo ammi natalia almonacid vanessa sos re vonita y sack igual los re quiero a todos son los mejores a ten do eel cd de high scool mucical tengo el 1y el 2 porfavor respondanmen
Fecha: 2007-10-24 12:50:58

Abi escribió:
Chad estas cañon
Fecha: 2007-10-28 09:36:25

noemi escribió:
Hola soy noe...SoY fAn de HsM SOBRE TODO DE ZAC!! Tengo todo pero me gustaria saver por que no va a salir vanessa :'( estoi muy preocupada por q era mi 2 fans i ...YatA UN BESAZO [...De Noe*...]
Fecha: 2007-11-03 07:29:39

katherin camila escribió:
me gustaria q pongan mas juegos donden nos reten jugando.
Fecha: 2007-10-28 12:07:59

zoraida escribió:
Fecha: 2007-10-27 10:36:45

Paula escribió:
zac efron eres el mejor del mundo y estas mu gueno te quiero¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡
Fecha: 2007-11-01 07:35:43

tania lizette escribió:
yo les kiero desir ke me impactaron kon la peli de high school musical 2 zac nose site avian dicho ke eres el mejor de todos ERES EL #1 $T.K.M GRAXIAS X NADA
Fecha: 2007-10-28 15:53:28

trinidad domizi escribió:
me gusta high school musical y me gutaria ser como ashley tisdale ( sharpey) es mi peli favorita tengo el cd de hsm 1 y hsm 2
Fecha: 2007-10-28 17:38:22

yanira jasmin giron flores escribió:
kiero decirle a zac y vanessa que hacen bonita pareja como novios y ojala que me mandaran un mensaje los quiero mucho con cariño
Fecha: 2007-11-01 16:13:25

CLARISSE escribió:
Fecha: 2007-10-28 15:24:06

♠ high school musical son estupendos agreguenme a su los amo de nancy
Fecha: 2007-11-01 17:31:32

karla escribió:
hola troy eres el mejor fijate que te tengo envidia por q1ue gabriela es tu novia en la pelicula pero en persona a de ser una aprobechada te amo!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Fecha: 2007-11-01 17:56:06

DIANA escribió:
hola yo pienso k deberian aber juegos de high school musical para ke los niños y niñas cantaran y ke les dieran puntos y esos puntos los cambiaran por premios a conciertos de high school musical byee saludos para nalleli y lorena
Fecha: 2007-10-27 13:29:06

nilsa escribió:
hola como estan todas y zac y vanessa :) me gusta su peliculas el 1 y 2 nada mas quiero ver 3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18 y el 19
Fecha: 2007-10-27 13:33:13

CLAUDIA escribió:
Fecha: 2007-10-27 14:24:51

marcela escribió:
oli lucas eri muy lindo te kero ya xaito besos
Fecha: 2007-10-27 14:33:14

asley tisdal escribió:
zack hahaha < is beautifuul
Fecha: 2007-10-27 15:14:24

flor escribió:
troy y sharpei se aman
Fecha: 2008-01-09 20:00:34

nayara escribió:
Hola soy Nayara high school musical es lo mejor de disney channel y es mi mejor programa .Vannasa eres muy guapa y muy cariñosa un beso para todos muuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuac
Fecha: 2008-01-10 08:49:18

marianela escribió:
son lo mas todos y me encantaria que agan un espectaculo en tres arroyos
Fecha: 2007-10-27 17:47:49

laura escribió:
me encanta high school musical zac eres muy guapo y tu tambien vanessa y tu asley soy todos muy guapo mi msn es y el vuestro estoy super nerviosa por veros a todos y sobreto a zac y a vanessa.yo vivo cerca del campo de giblaltar en san roque un pueblo de cadiz vais a venir alguna vez por favor . besos a todos y sobretodo a zac y a vanessa guapos mucho más zac efron
Fecha: 2007-11-01 20:55:23

valentina escribió:
hola a todos los quiero un beso
Fecha: 2007-10-27 18:53:18

gabi escribió:
esta re buena la peli
Fecha: 2007-10-27 18:59:31

camila escribió:
esta super genial la peli!!!!!!!!!!! sobre todo la sharpay q es super fabulosa!!!!!!! q hasta se parece amy!!!!!!! xao
Fecha: 2007-10-27 20:58:36

daniela escribió:
Es fantastico por los bailes y las canciones las esena !!!!!! sobre todo zac efron q esta guapisisimo!!!!!!!!xao........
Fecha: 2007-10-27 21:03:40

francisco escribió:
esta re guenala pelicula !!!!!!! sobre todo sharpay y gabriella son muy lindas!!!!!!!!!!!!!!!!!!!!!!xao......
Fecha: 2007-10-27 21:10:48

carolina escribió:
ola... me encanto la pelicula estubo super wuena ...soobre todo Zac Efron q ES SUPER LINDO ME ENCANTA SU CANCION BET ON IT .. espero con ansias la pelicula high school musical 3 pero espero q esa pelicula el Ryan se vista mejor por q parece mujer :( .........xd.....xauuuuu
Fecha: 2007-10-27 21:16:00

marifer escribió:
hola a todos oseA vannesa zac efron y ashley tisdale corbin monique quiero decirles que sonlo mejor y que me encanta sus canciones y ahorita estoy aprendiendome sus canciones me gusto mas la pelicula de high school musical 1 la dos se me hizo lenta los quiero pero algo si no me gustan de enamorar zac jaja lo siento pero adoro a todos!!!! bechos!!!(besitos)cuidense.
Fecha: 2007-10-28 20:15:24

eduardo escribió:
me gusta las canciones de la pelicula y brayan deja la sifrines besos para gabriela
Fecha: 2007-10-29 09:00:53

ARTURO escribió:
Fecha: 2007-10-29 10:33:14

camila escribió:
Hola yo soy la fan número uno de Zac Efron y el es hermoso
Fecha: 2007-10-29 16:21:54

dulcesito escribió:
zac hola soy dulce quiero decirte que tienes unos ojos hermosos yo tengo tu poster sabes me gustaria ser gabriela. te quiero mucho. att: tu fans #1
Fecha: 2007-10-29 18:28:08

gabriela de zac escribió:
hay dios no me canso de decirte que esres mu guapo tengo 9 años y deseo que me venga s a vee aqi en comitan de dominguez chiapas vivo en el puente hidalgo en la 2ºavenida oriente sur estudio ingles y computacion porfa zac ven a visitarme ya te di todos mis datos
Fecha: 2007-10-29 18:37:02

nerea escribió:
zac eres el mejor tequieroooooooooooooooooooooooooooo
Fecha: 2007-11-03 09:25:01

CLEMEN escribió:
hi my name is clemen i love high school musical this is beautifull but i speek spanish jijijijiji 1 kiss
Fecha: 2007-10-30 10:11:48

hanna escribió:
hanna montana la mejor del mundo mundial. y high school mucical es la mejor peli del mumdo la mas wapa es asley tisdale y el mas cañon zac efron y ryan esta ccomo un tren pero es mejor zac efrony elotro es feo vannesa hundens es bastante wapa
Fecha: 2007-10-30 12:38:08

Eva escribió:
vanessa eres wapisima Ashley lo mismo digo wapa!!!!!!!!! zac eres wapisimo corbin bleu tu tambien i lucas gabreel suerte que ahora estas con zac i esos espero que sigais asi os quiero a todos esa musica muaaaaaaaaaaaa
Fecha: 2007-11-02 06:04:10

Maria escribió:
Es genial lo mejor de mi vida nunca habia visti nada igual que pena que no ablen mi idiona que sino... Zac David Alexander Efron eres el mejorrrrrr Guapo I love you The best
Fecha: 2007-11-02 07:44:51

dulce escribió:
no les agas caso zac yo soy tu fans #1
Fecha: 2007-10-30 18:15:30

maria fernanda mendoza eleuterio escribió:
zac soy tu fan numero 1, de todo el mundo eres el mejor juntate con sharpay por que con vanesa ay me cae mal perdon jajaja
Fecha: 2007-10-30 19:20:27

sergio dairo escribió:
no se como juega alguien me puede decir como se juega
Fecha: 2007-10-30 20:43:23

coral escribió:
me llamo coral y le quiero decir a zac que esta muy bueno y QUIERO SU MSN besos la fan nº 1 CORAL
Fecha: 2007-11-02 08:06:51

maria tamayo escribió:
hola amigos de h.s.m los veo todos los dias en el disney channel me encanto h.s.m2 la veo todo los dias me encanta la cancion eres la musica en mi bueno solo les dejav un saludita su fans numero #1 bexitos pra zac y para ashley tambien para vannesa y para teylor chao ****maritax**** bexitossssssssssss.......
Fecha: 2007-10-31 11:55:59

celia escribió:
Soys los mejores del mundo besos de celia
Fecha: 2007-10-31 12:22:09

laura lisbeth escribió:
mu jevi high school musical mi mejor icula y juego de toda mi vida
Fecha: 2007-11-03 14:32:43

Kristina escribió:
Chad estas cañon
Fecha: 2007-10-31 15:48:50

ana escribió:
uauuuuuuuuuu ¡¡¡ es la mejor peli de la vida enteraaaaaaaaaa
Fecha: 2007-11-10 08:12:51

troy escribió:
vannesa ere la mjo zac,chad y ryan soys los mejores
Fecha: 2007-11-10 09:05:10

lorena escribió:
lo mismo digo xd
Fecha: 2007-11-03 11:55:09

BERTA escribió:
vanessa quiero ser como tu¡¡¡ soy tu fan numero 1 te tengo por toda mi habitacion¡¡ jejeje
Fecha: 2007-11-02 08:58:12

fani escribió:
high scool musical es el mejor del mundo os kierop muchop !!!!!!!!
Fecha: 2007-11-02 10:03:05

maria escribió:
Ashley estas buenisima y Lucas tambien. Me a encantado la pelicula 1 pero la 2 esta mejor que se besan zak y vanesa, pero ami me gusta Ashley y Lucas.Un beso a todos.
Fecha: 2007-11-03 14:46:36

patro escribió:
high school musical 2 es genial¡¡¡¡¡¡¡¡¡¡¡¡¡¡ me encantaron sus dos pelis y los protas son geniales¡¡¡¡¡¡¡¡ espero que me contrateis pa hacer alguna de peli de ese estilo e???? os espero cn entusiasmo
Fecha: 2007-11-02 10:14:57

sole escribió:
zac (troy) es un mijito rico me encanta es muy guapo
Fecha: 2007-11-02 13:36:20

rocio escribió:
hola me llamo rocio y quiero conoser los chicos de high school musical 2 chau ya tengo que irme despues seguimos
Fecha: 2007-11-03 15:34:47

harold arevalo escribió:
me gusta su pelicula quisiera que la pusieran mas y aque hisieran mas pelicualas de high school musical y que hagan mejores canciones aparte de esta que son las mejoresque e visto y high school musical 3 pusiera que troy y gabriella fueron novios gracias por hacer las dos peliculas gigh school musical att harold orlando arevalo illidge
Fecha: 2007-11-13 19:19:45

maria jose escribió:
me gustaria jugar con los personajes troy y grabriela pero que se den vesos para que el juego sea mas entretenido porfa agan un nuevo juego chao bay chao chayto muchos vesos a troy y a gabriela
Fecha: 2007-11-02 15:48:46

bianca escribió:
me gustaria jugar com todos los personajes de high school musical 2
Fecha: 2007-11-02 16:12:39

katy escribió:
hola todos como estan soy la mejor fan de LUCAS GABREELL osea rayan evans. soy su fan numero 1 de LUCAS GABREELL
Fecha: 2007-11-03 19:03:08

dara escribió:
los amo mi cumple tambien es el de monique coleman diganselo please bye amo su programa saludos para todos
Fecha: 2007-11-10 09:45:21

guadalupe escribió:
todos me encantan son mis fanaticos como quisiera verlos en persona seria mi gran sueño y me gustan especialmentezac efron y corbin los adoro los amooo!!!!
Fecha: 2007-11-10 10:33:18

katy escribió:
hola VANESSA (gabriela)canta bien bonito. ella hace muy buena pareja con nzac (troy) y en la vida real son novios. espero que se casen muy pronto
Fecha: 2007-11-03 19:10:07

stephania escribió:
ami me gustan todos los personajes menos asheley por que en la vida real es muy presumida aparte que en la pelicula y me cay muy gorda pero yo soy la fan numero 1 de vanessa anee hudgens y se todo acerca de ella como que es signo sagitario o como que su hermana se llama gina y espero que sea muy feliz cundo se cas econ zac efron le ecomiendo que no se case con asheley es horrible y presumida en canbo v es hermosa y canta hermoso no no hermoso divino,bueno no palabras para describir su voz acen un a pareja hermosa y les deseo l mejor y VANESSA QUISIERA SER COMO TU ATE.f son los mejores
Fecha: 2007-11-02 17:02:12

las gatitas escribió:
holaa!! le doy todo a zac es hermoosooo... papiii
Fecha: 2007-11-02 17:12:14

carla escribió:
holaaaaaaaaaaaa!!!!!!!!!!!!!!!!!! confiezo que me encanta zac y vanessa me encantan sus pasos realmente me fascina esa pelicula !!!!!!!! chauuuuuuuuuuuuuuu!!!!!!!!! muchos besos para todos!!!!!!!!!!!!!!!!!!!
Fecha: 2007-11-02 17:50:00

alejandra escribió:
hola a mi me encenta hanna montana y me facina high scool musical creo que asheli y zac harian una linda pareja siempre en micasa veo la peliy no me aburo porfis asheli dame tu imeil y tambien tu maili mi correo es an y tambien vannesa
Fecha: 2007-11-02 18:37:38

rosiña escribió:
qu` troy es simpatico
Fecha: 2007-11-02 19:43:14

Fecha: 2007-11-02 20:09:44

mari escribió:
hola me llamo maria ines. y q vana hacer la pelicu 3 ¿como se entrar a los juegos?
Fecha: 2007-11-03 01:00:05

Alba escribió:
Hola soy Alba y Soy fan de Zac Efron y de Vanesa Hugens ,pero no me parece nada bien que a vanesa le quiten el contrato de Disney Channel y seria mucho mejor que hicieran High School Musical 3 con vanesa.
Fecha: 2007-11-03 04:31:06

la loca de la pelicula(berta) jeje escribió:
todos los que participan en high school musical son geniales, aunque algunoss...... ya sabeis a lo que me refiero, por supuesto no quiteis a ninguno de los protagonistas por favor.....
Fecha: 2007-11-04 04:31:22

marina escribió:
sois los mejoresssssssssssss del mundo
Fecha: 2007-11-04 06:21:11

fernanda escribió:
me facina zac efron es demaciado lindo pare ser sincera igual de lucas soy la fans 1 de zac
Fecha: 2007-11-04 06:45:27

yechi escribió:
hsm es lo +... me encanto la peli y espero q pronto salga HIGH SCHOOL MUSICAL 3... zack estas re FUERTE!!!(
Fecha: 2007-11-04 09:02:52

maria escribió:
hihg school musical es una pasada qe agan 1 cada año porfavor qe sigan con esa pelicula es una pasada me an comentado qe van a acer la 3 no os la perdais va ser una super pasada qe guay espero qe agan la 4 la 5 la6 la 7 la 8...................eso espero y los qe teneis disney chanel no os la perdais es super chula. gracias
Fecha: 2007-11-04 09:23:53

Alba escribió:
me a gustado mucho las pelis un beso ¿high scool musical
Fecha: 2007-11-04 09:39:05

Shara escribió:
High school musical 2 esta xulixima!!! m gustarian k sacaran ya la tercera... es verdad que vanessa ya no estara en high school musical 3?? Pobrecilla a mi me gustaba muxo!!! Aran conciertos en españa?? Si alguien me quiere agregar este es mi msn: ARRIBA HSM!!!
Fecha: 2007-11-04 09:40:39

yamilly garcia escribió:
mi comentario es k no deberian poner tantas letras, ustedes no se cansan las manos escribiendo todo eso ATT:Yamilly...
Fecha: 2007-11-13 19:29:34

belen herrera escribió:
ami tambien me gustaria que vane estuviera hai pero ya no podemos hacer nada buno espero que no haga lo mismo lucas,zac,ashli,y los de mas bueno ma despido y hagan high school musical 3
Fecha: 2007-11-04 10:50:03

isabeau escribió:
high school musical es genial deverian aver juegos pa que nos entrengamos. Ahhh y la 1 no me gusto es muy infantil para mi encambio la 2 es mejor mas abierta no lo se y que el troy con la gabriela agan algo divertido como que se les vea en la cama no lo se. chaufa
Fecha: 2007-11-04 13:54:47

carolina escribió:
zac eres re lindo kiero k agran high scool ...3 pero k el zac no ande con (sharpey)iu...XD zhaii
Fecha: 2007-11-04 14:06:31

belu y lucas escribió:
hola somos belu y lucas y nos encanto la peli el beso de troy y gabriella estuvoo mortal y espero que haya una tercera,cuarta,quinta y asi sucesivamente hasta q nos cansemos pero la realidad es ahora hay q disfrutar y disfrutar esta segunda parte...bueno saludos :)8)=)
Fecha: 2007-11-13 13:04:08

ayelen escribió:
Troy soy tu fan numero 1 eres el k esta mas bueno de todos es la mejor peli de mi vida
Fecha: 2007-11-13 14:24:59

yubraska escribió:
yubraska mira zac eres muy lindo me encantan tus ojos que son azules me encanta ver high shool musical2 vannesa es tambien linda y yo quiero un autografo de todos los que inter pre tan ahigh scool musical por favor mandamelo y a shrpai eres muy linda pero muy creida los quiero mucho a todos.
Fecha: 2007-11-04 16:30:50

ana avendaño escribió:
holaaaaaaaaaaaaaaaaaaaaa son lo max
Fecha: 2007-11-13 10:02:47

ariane escribió:
hol@ soy ariane de ablitas de la c/don pedro arriazu n:9 ablitas/navarra españ mis fans os quiero mucho y me gustaria mucho conoceros en verdad soys los mejore me encanta vuestra musica y me encanta troy:zak efro te quiero un monton guapo y tu gabriela:vanessa hudgens eres la mas wpa os quiero un monton soys los mejore guapos arine.......??¿¿contestar
Fecha: 2007-11-13 13:03:23

nadia arosquipa chung escribió:
bueno la pelicula me parese muy bonita pero tien algunas cosita pero bueno quisiera que las peliculas despues de un tiempo las pusieran en el internet y tambien pusieran juegos para jugar sobre de su pelicula pero no ese jugo de que nosotro hagamos una pelicula y capas la escojian para su segunda pelicula bueno quisiera un jueg donde nosotro los pudieramos manejarlos a los personajes de hai school musical que les vaya muy bien y que prosperen mucho pero mucho asta la proxima
Fecha: 2007-11-07 17:16:15

Fecha: 2007-11-04 17:37:43

gabriella de argentina escribió:
zac eres el mas lindo besos a todo el elenco los quiero mucho gabyyyyyyyyyyyyyyyyyyyyyyyyyy
Fecha: 2007-11-04 18:33:02

XIYEN escribió:
Fecha: 2007-11-12 15:30:14

nadia arosquipa chung escribió:
bueno la pelicula me parese muy bonita pero tien algunas cosita pero bueno quisiera que las peliculas despues de un tiempo las pusieran en el internet y tambien pusieran juegos para jugar sobre de su pelicula pero no ese jugo de que nosotro hagamos una pelicula y capas la escojian para su segunda pelicula bueno quisiera un jueg donde nosotro los pudieramos manejarlos a los personajes de hai school musical que les vaya muy bien y que prosperen mucho pero mucho asta la proxima
Fecha: 2007-11-07 17:16:20

Camila escribió:
todos los de high school musical son re lindos y estan re buenas las peliculas.De los que mas me gusta es gabeiela y troy son re lindosss.
Fecha: 2007-11-07 18:06:57

camila escribió:
high school musical es lo mejoyr troy y gabriela!!!!!
Fecha: 2007-11-07 18:10:50

silvana escribió:
holas bueno me encanta ver high school myusical 2 estaria bueno que salga la 3 asique la espero byebye
Fecha: 2007-11-05 08:55:24

juliana escribió:
zac sos divino te amo con todo mi corazon sos el amor de mi vida!!!!!
Fecha: 2007-11-07 19:54:14

gianella escribió:
me encanta jugar high school musical porq esta troy me gusta mucho
Fecha: 2007-11-05 09:51:44

Alba escribió:
grabiela y troy bolton sois los mejores me encantais un beso xao
Fecha: 2007-11-05 13:32:43

camila escribió:
adoro amo a high school musical 2
Fecha: 2007-11-05 19:13:04

alejandra escribió:
si son hsm quiero decirles que esto no inporta quie lo leea porque no me gusto lo que vanassa new iso y que zac efro no le combiene que sea su novia y yo creo que le quedaba mas hasly
Fecha: 2007-11-05 20:18:26

ALAN escribió:
Fecha: 2007-11-05 20:27:16

XIYEN escribió:
Fecha: 2007-11-12 15:25:05

xiyen escribió:
ami me gusta muxo hsm pk grabiella tiene nacionalidad xina i española.(je je)cantan de maravilla son los mejores actores para mi soi un ssssssuper fan de gabriella montez.os kiero
Fecha: 2007-11-06 12:52:05

gabriela veras reyes escribió:
eres la mala de high school musical
Fecha: 2007-11-08 09:15:00

genesis escribió:
hola me gusta como son nesecito ssus correo es que mi hermana se llama vanessa pero le dicen gabi
Fecha: 2007-11-06 13:16:48

barbara javiera escribió:
Fecha: 2007-11-06 14:00:10

anonimo escribió:
te amo corbin sos el mejor de todos...................los amo!!!! chau
Fecha: 2007-11-08 12:05:00

camila escribió:
hola me llamo camila y los quiro conoser a todos entonse le deje mi msn para q me hablen por ahilos quiero muchochicimo yo soy famosa de ustedes
Fecha: 2008-12-19 13:16:46

camila escribió:
hola como andan su peli la 1 2 3 fue un exito
Fecha: 2008-12-17 15:59:34

katia paola escribió:
es bacno y me gusta besos para troy y gabriela
Fecha: 2007-11-08 17:22:14

diana escribió:
ay troy vos estar bien guapo les recomiedo hsm y ver el zz esta super xido.
Fecha: 2007-11-08 17:40:56

karla escribió:
q sopa hsm le mandamo un saluo desde panama colon
Fecha: 2007-11-08 18:30:16

s@ndr@ escribió:
me gustaria conoceros en la vida real si kereis escribirme este es mi y ya k me escribis darme el veustro kiero ablaros muxos bbbbbbbbbbbbbbbbssssssssssssssss con muxo cariño:de s@ndr@
Fecha: 2007-11-12 09:29:30

angie viviana vanegas triana escribió:
los amo a todos, pero mi preferido es CORBIN BLEU,ES EL MÁS LINDO Y ME GUSTA MUUUCHÍSIMO.CHAO
Fecha: 2007-11-10 16:18:09

caroline patricia escribió:
me gusta mucha la peli, es muy bonita y chevr ... byeeee los amoooooooooooo carolllineeeeeeeeee
Fecha: 2007-11-09 14:44:36

katia baques garsia escribió:
los quiero mucho los amo mi hermano tamnvien adios bye
Fecha: 2007-11-09 16:34:34

marcelo escribió:
todos cantan muy bonito y tambien la q toca
Fecha: 2007-11-09 17:52:31

roxy escribió:
hola soy roxy y me encanta hihg school musical 2 a sido la bomba os kierooooooooooooo!1!!!!!!!!!!!!!!!!!!!!
Fecha: 2007-11-14 11:09:26

daniela paz escribió:
yo kiero ser la nueva sharpay porque kiero ser famosa y conoserla el persona y estar con ellos me encantaria xhao xhau
Fecha: 2007-11-14 11:26:39

itzel escribió:
yo opino que high scool musical es mui divertido para nosotros los chiquito los quiero mucho
Fecha: 2007-11-10 18:50:32

soraya escribió:
es una mega pasada! es muy xulo!
Fecha: 2007-11-11 03:40:17

paula escribió:
hola me llamo paula soy de lanjaron bueno me encantas troy aver si un dia te veo en eprsona seguro que me tiraria a tus brazos como una loka!!!!! jeje:p bueno xaooo
Fecha: 2007-11-11 06:37:26

rocio escribió:
Me encanta high schoo mucical 1,2 y que salga la 3. bueno que la pacen bien grabando la cancion si esque sale la 3 y pacenla bien y le mando un beso a todos ,gabriella y a los de msa besos y gracias chuuuu.
Fecha: 2007-11-14 13:44:07

claire escribió:
hola soy claire!!!! la peli es chulisima y mis amigas nos parecemos a las tres chicas de high school musical gabriella a julia sharpay a mi y a taylor lucia
Fecha: 2007-11-11 09:12:00

claire escribió:
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa me muero con el beso que se hacen al final de la peliiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Fecha: 2007-11-11 09:14:50

aldana escribió:
hola soy aldana y bengode argentina y megusta mucho buestra pelicula todos son guapos y guapas bueno esto estodo chauuuuuuu un beso.
Fecha: 2007-11-14 13:53:20

camila escribió:
son los mejores del mundo gabriela y troy son fantasticos los quiero mucho chaoooooooooo de:camila para:gabriela y troy
Fecha: 2007-11-11 16:32:00

mayra ancaya aguilar escribió:
quiero ser la nueva gabriella montez estoy muy emocionada x ser ella
Fecha: 2007-11-11 21:01:54

sandra escribió:
es va can locaso y quiero mucho a zac efron uuuuuuuuuuuuu
Fecha: 2007-11-14 17:39:16

sheara escribió:
que troy es el mas lindo
Fecha: 2007-11-19 10:57:43

JAVIERA escribió:
Fecha: 2007-11-15 13:16:24

ALENKA escribió:
bueno de todos los dibujos me gusta high school musical y quisiera conocerlos atodos mi autor favorito es vanessa hudgens y tambien zack gracias por escuchar mis comentarios chauu
Fecha: 2007-11-19 13:33:48

camila escribió:
hola yo opino que zack y vanesa son muy fantasticos , agregame en tu msn zack y vanesa porfa mi msn es isi no funsion pongan esto , un saludo a todos los de high school musical chaooooooooo de:camila para:todos los de high scool musical
Fecha: 2007-11-15 17:24:37

rochy!!!! escribió:
la peli esta buenisima!!!!la 1 y la 2
Fecha: 2007-11-19 14:58:30

Eva escribió:
me gustan zac efron y gabriella montez tanbien sharpayy ryan en verdad chad y taylor tambien mr gustan a y kelsi y martha me gustaria te ner vuestro msn por fa con testad os dejo adios un beso para todos a y tengo un monton de cosas de ustedes y oy llevo el chandal rojo de high school musical 2 XAO GUAPOS
Fecha: 2007-11-26 08:14:39

Noeliaa escribió:
olaa ami me usta muxo high school musicxa kero k engan a españaa ombree a cadiz a k de un concierto ira to er mundo enga animarse y venir
Fecha: 2007-11-29 07:42:12

carolina escribió:
hola zack te quiero muchisimo te voy a mandar este mensage bueno ya me tengo que ir me bye
Fecha: 2007-11-15 22:47:35

Camii escribió:
Bueno ami me encanta Zack Efron..lo amoòò!! Es hermoso..! Y adoro la pereja q hace con Vanessa Hudgens!Y cmbiando de tema me parece q tendria q aver muchos juegos y qe haya un concurso donde nosotros podriamos ir a visitar a los de high shcool musical 2,estaria re bueno! y qe haya un viaje para ir a disney..! Bue creo qe es re linda la idea! Me voii..adiioss!!
Fecha: 2007-11-26 08:22:26

SANTIAGO escribió:
Fecha: 2007-11-19 16:56:59

solci escribió:
bueno... hooolaaa les qrei decir q high school esta muy bueno pero aveces exajeraaaan... bueno besos para los q leen la pag sol
Fecha: 2007-11-16 07:47:17

maria escribió:
zac te amo mucho te adoro
Fecha: 2007-11-16 08:53:07

berta escribió:
no sabeis como os adoro a todos, aunque a la que mas a vanessa, eres la mejor¡¡
Fecha: 2007-11-16 10:58:30

noemi escribió:
hola no sabes como los quiero i porsupuesto a zac lo amo y a vanessa los adoro a todos un beso a todos selosmanda su acmiradora noemi
Fecha: 2007-11-16 14:17:17

florencia sol escribió:
hola me encanta high school musical 2 y la 1 me encntaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Fecha: 2007-11-16 14:38:37

alessandra cordero escribió:
me gusta a sherpey y troy porque son los más huapísimos los amo.
Fecha: 2007-11-16 15:20:41

Me gusto mucho cuando salen Gabriela y Troy Bolton este nuevo exito me callo de maravilla tengo 11 y los admiron OK ATTE BRENDA JUDITH FRANCO GUZMAN
Fecha: 2007-12-04 15:16:13

magli escribió:
hello, hola ,sot maga amo pero amo alos de high scool miusical son los mas son my favorites actores hay dios no se como explicar que "los amo". bueno ashley tidale es lo mas , vanessa ungles actua usper super bien ,eso no significa que ashley no actue bien ,.porque todos actuan bien.troy es lindo y por supuesto actua muy bien,ryan es muy bueno bailando y no miento,tambien es muy lindo,y moni es buena cantante,por ultimo esta corbin blue chau
Fecha: 2007-11-16 19:07:38

magli escribió:
hello, hola ,sot maga amo pero amo alos de high scool miusical son los mas son my favorites actores hay dios no se como explicar que "los amo". bueno ashley tidale es lo mas , vanessa ungles actua usper super bien ,eso no significa que ashley no actue bien ,.porque todos actuan bien.troy es lindo y por supuesto actua muy bien,ryan es muy bueno bailando y no miento,tambien es muy lindo,y moni es buena cantante,por ultimo esta corbin blue chau
Fecha: 2007-11-16 19:07:55

giovanni michel escribió:
me gusta disney por los juegos haigh cool musical
Fecha: 2007-11-16 23:36:20

andrea escribió:
yo e visto unas fotos de vanessa hudgens y zac efron que se dan u morreo (un beso) y la pag. web es vanessa hudgens y zac efron y si quereis ver a vanessa desnuda poned vanessa hudgens desnuda.
Fecha: 2007-11-17 03:32:49

luis rene escribió:
es fantastico me gusta tanbien su pelicula que an rodado tengo su pelicula la de high school musical 2 y tanbien la primera soy buestro fans numero uno me guntan bustras peliculas os acmiro a chad a troi a vanessa a sharpei a todos bueno a dios el fans numero uno
Fecha: 2007-11-17 05:33:24

josefina escribió:
ami me encanta high school musical 2 todas mis amigas les encanta zac efron ami me encanta mucho que tengan suerte todo los personajes de high school musical 2
Fecha: 2007-11-17 05:49:02

mirian escribió:
ami me encanta high school musical 2 todas mis amigas les encante zac efron ami me encanta mucho que tengn suerte todo los personajes de high school musical 2
Fecha: 2007-11-17 06:26:51

jennifer abigail escribió:
me encantó su pelicula quisiera ir a su foro tamvien tienen muy suaves juegos me encanto ¨HIGH SCHOOL MUSICAL 2¨ LOS QUIERO
Fecha: 2007-11-26 10:36:08

aitana escribió:
zac vanessa sois lo mejor hacer algun concierto aki en valencia xao os kiero un monton a los dos el sueño k tengo yo es poder beros en persona es mi sueño
Fecha: 2007-11-17 06:34:29

aitana escribió:
zac vanessa sois lo mejor hacer algun concierto aki en valencia xao os kiero un monton a los dos el sueño k tengo yo es poder beros en persona es mi sueño i kiero k se aga realidad kon todas mis fuerzas
Fecha: 2007-11-17 06:38:00

lidia escribió:
donde me puedo meter para jugar a algo de hihgschoiol musical?
Fecha: 2007-11-17 06:39:17

noelia escribió:
zac efron y vanessa algun dia ire a inlaterra adias fans
Fecha: 2007-11-17 07:22:17

agustina escribió:
high scholl musical es lo mas. zac y vanessa acen una linda pareja me encantan amo a sharpay me parece que es buena despues de ser mala
Fecha: 2007-11-17 08:23:56

alessandra vasquez dias escribió:
vannesa te quiero mucho es berdad que estas envarasada me gustaria que tu seas mi mama y que nombre vas a ponerle a tu hija o tu hijo dame tu mail respondeme y dame tu mail y mado saludos a zac te quiero tego 5 años
Fecha: 2007-11-17 11:22:54

andrea muñoz escribió:
chicos su peli es lo mejor que he visto en todo el año es una plicula que nadie la podria hacer solo utd. los amo. zack efron es super lindo
Fecha: 2007-11-17 12:39:34

diana escribió:
corbin blue estas buenisimo eres mi hombre perfecto de la vida y por supuesto tambien zac ecfron estas buenisimo vanessa eres muy bonita y cantas super eres buena y ahsley eres como yo de vanidosa ok todos ustedes son geniales y les quedo perfecto la peli son geniales lo quiero aria todo por verlos
Fecha: 2007-11-17 13:03:56

zyanya ximena escribió:
Fecha: 2007-12-03 15:17:20

Ariane escribió:
Oi eu tenho 10 anos,moro no Brasil,eu sou muito fa de voces muito mesmo principalmente da Gabriela e da Sharpai. um beijao grande para vcs porfavor me mandas uma mensagens. tchauuuuuuuuuuuuuuuuuu!!!!!!!!!!!!
Fecha: 2007-11-21 05:32:33

camila escribió:
haaaaaaaaaa gusta high school musica 2 es tanbuenaaaa me encanta espero conocerlos a todos un dia a mi hermanito le gusta igual sienpre cuando lo dan po disney lo veo no me la pierdo buenoun saludo a todos los chico de high school musical 2 chaoooooooo besoooooooooo yo soy de chile
Fecha: 2007-11-20 13:50:58

agustina escribió:
hola los juegos son bueno y yo siempre me meto para jugar con los juegos de HIGH SCHOOL MUSICAL 2 me llamo AGUSTINA tengo 8 AÑOS y soy de MENDOZA en Fin tengo 4 PERRAS/OS tengo 2 PERRAS y 2 PERROS son 2 HIJOS y los 2 PAPAS BESOS CHAU
Fecha: 2007-11-20 14:08:22

Laura Pereyra Benito escribió:
Fecha: 2007-11-17 13:08:46

manuela escribió:
hola les quiero comentar que me facina ver las pelis que dan en disney channel una de las que mas me ha gustado es HSM y HSM2 si alguien me quiere hacer algun comentario por favor escribanmen a mi MSN que es por favor agreguenmen y se van a divertir mucho
Fecha: 2007-12-04 20:20:29

julia escribió:
zack es lo mejor y ase un muy buena pareja con sharpey que es re linda en cambio gabriela es re fea y tonta creida en realidad es mejor con migo jaja bueno chicas y chicos que lean esto zack es lo mejo o no?¿
Fecha: 2007-12-03 20:34:20

marta,albayesther escribió:
ke pongan mas juegos, musica y cosas en internet de high school musical ¡¡¡¡¡ nos encanta high school musical!!!!!!!
Fecha: 2007-11-26 12:28:21

Fecha: 2007-11-26 14:14:24

Julieta Mateljan escribió:
Zac y Gabriela los ¡amooooooooo! son re linda pareja y me gustaría verlos en persona y agan un concierto gratissssssssss porfis:) yyy ¡aguante hsm 1y2! pongan mas juegos siiiiiiiii:) de hsm 2 y Gabi y Zac pasenme su msn :) aca le doy el mio los re ¡adoroooooooooooooooooooooooooooo son genialeeeeeeeeeeeeeeeeeesssssssssssssssssssssssssssss! juli Mateljan 26 de noviembre de 2.007 :) :) :) :) :)
Fecha: 2007-11-26 15:45:18

gabriela escribió:
hola high soy su mas grade admidadora
Fecha: 2007-12-04 15:53:48

jessica escribió:
hola me llamo jessica a mi amiga liselot le gusta mucho a troy chao!!!!!!!!!!!!!!!!!!!!!!!
Fecha: 2007-11-21 17:07:59

barby y evelin escribió:
HOLA SOMOS EVE Y BARBY: keriamos decirles que somo fans de hsm y hsm2, esta re bueno troy. kisieramos estar con ellos. me gustaria conocerlos mas. LOS KIERE NUCHO EEEEVVVVEEEELLLLIIIINNNN YY BBBBAAAARRRRBBBBYYYY BBEEESSSSOOOOOSSSSSS!!!!!!
Fecha: 2007-11-21 18:07:33

victoria escribió:
son la mijor hsm los amom un beso!!!!!!!!!!!vaicky
Fecha: 2007-11-21 18:32:04

diana escribió:
Fecha: 2007-11-21 20:08:33

noemi escribió:
me encanta higs shcool muisical y bueno adios y espera k saces la pelicula 3
Fecha: 2007-11-22 06:02:07

KANDE escribió:
hola? como andan todo bien bueno les queria decir a gabriella y a troy que les mando un beso enorme bueno yo quisiera darle mi mi correo que es y quisiera decirle que si me podran darme el msm de troy y de gabriella porfavor esto es para ustedes lo adoro y los kiero como me gustaria que troy y gabriella sean novios por que hace una pareja muy linda bueno me despido con un beso enorme chau chau chau chau chau besito..............
Fecha: 2007-11-29 12:55:25

pamela escribió:
amo a zac efron aunke sea gey odio a vanessa hudgenes
Fecha: 2007-12-03 17:33:05

Nue soy idiota escribió:
No se pero ami la mejor y la que mejor esta en la pelicula es Vanessa Anne Hudgens es muy buena de actriz y cantante tambien Zac Efron (troy) bueno eso es todo adiós
Fecha: 2007-11-22 10:57:16

corna escribió:
holaaaaaaaaaaaaaaaaaaaaaaaaaa mandame tu musica hotel dulce hote soy mayte
Fecha: 2007-11-22 11:15:09

alazne escribió:
vanessa hudgens no hagas caso a esa tal laura tu no eres descarada a me llamo Alazne soy tu mallor fan ¿tiene messenger? ¿te doy el mio? es Agur.
Fecha: 2007-11-22 13:35:47

diana escribió:
miren yo quiero que zac y ashley deberian ser novios quedan perfecto y obio vanesa es muy linda quedaria con corbin blue y yo daria mi vida por que zac y asley quedan superyo daria hasta mi vida para que estubiran juntos lo que me pidan lo haria son super todos la peli es jenial les quedo bien pero yo quiero que queden de nobios asley y zac bye y adios chau besos
Fecha: 2007-11-17 13:13:12

JULIO escribió:
Fecha: 2007-11-17 14:13:41

elcaris escribió:
hola chicos como estas la pelicula es muy buena demaciado buenicima saludos soy elcaris gusto de conocerlo bueno chao chao saludos a todos al dirrector chao cuidense chao besos elcaris
Fecha: 2007-11-17 17:26:56

LILIANA escribió:
Fecha: 2007-11-17 18:27:21

lara escribió:
ola me encanta high school la vannesa hudens es la mejor porfavos espero que me den su e-mail
Fecha: 2007-11-18 08:20:08

rakel escribió:
amo a efronnnnnnnnnnn mi love lo adoro lo + bllo aunk christopher uckermann no esta mal busken sobre el y se sorprenderan
Fecha: 2007-11-18 09:40:26

florencia escribió:
que pongan mas juegos de ahly de zac de lucas de monic de vane corbin porfa y todos los personajes mas mucho massssssssssssssssssssssssssssss chauuuuuu besos
Fecha: 2007-11-26 12:14:47

alondra retamal saez escribió:
hola es muy bakan la peli zacc efron es muy bonito
Fecha: 2007-11-20 17:33:07

blanca escribió:
hola kiero mandar saludos a los HIGH SCHOOL MUSICAL soy fan num. uno de ellos por favor comuniquense con migo los adoro atte:blanca evelyn martinez villanueva y mi correo es gracias
Fecha: 2007-11-18 14:53:29

CAMILA escribió:
Fecha: 2007-11-18 17:01:17

paola vivo en la manga murcia escribió:
si hay alguien k haya escrito y sea de la manga(murcia)k me lo diga. eske zac es el mejor haria lo k fuera por ver a todos los personajes:i love zac efron un beso a todos
Fecha: 2007-11-23 04:18:54

laura liabeth escribió:
Fecha: 2007-11-18 19:05:02

diana escribió:
hola soon muy buen equipo de todos me gusta high school musica 2 bueno chao me gustaria conoserlos a todos
Fecha: 2007-11-18 20:02:48

itatí escribió:
YO DIGO QUE troy quiere a gabriela
Fecha: 2007-11-19 08:26:24

ainara escribió:
ami me gustan mucho todos solo qiero decir mucas garcias por hacer una pelicula buenisima todos los quiero. gasias
Fecha: 2007-11-26 19:00:33

octavio escribió:
soy fanatico de high schoo musical sobre todo a la gabriela y al troy
Fecha: 2007-11-23 10:49:12

nena fantasma escribió:
gabriella eres la mejor ,so wapa
Fecha: 2007-11-27 00:57:35

irene escribió:
octavio, eres de chiva? ske escribes en los nombres propios le pones articulos delante. Bueno respecto a eso, kiero decir k hsm 2 me a encantado tanto las cancion tanto la peliculo hsm, hsm 2 y rbd los mejores
Fecha: 2007-11-23 13:22:20

susana escribió:
hola quiere que me mandeis un mensaje con todas vuestras fotos sois lo mejor
Fecha: 2007-12-04 08:13:25

daniela escribió:
Fecha: 2007-11-23 14:12:13

camila escribió:
Fecha: 2007-11-29 19:22:43

ELIENAI escribió:
Fecha: 2007-11-23 16:14:13

connie fernanda fierro bravo escribió:
son bakanes los de high school musical
Fecha: 2007-11-23 16:22:36

CeCi Te Amo00000 PaTo00000 escribió:
la pelicula de haigh sco0l musical 2 esta co0n madre me gusta mucho0 tro0ll esta muy guapo0 bueno0 adio0s chao0000000000000000000000
Fecha: 2007-11-23 16:29:16

cecilia escribió:
hola como estan espero q bien bueno les queria decir q me encanto la peli muchisimo bueno me encantta sharpey bueno bechos
Fecha: 2007-11-23 16:33:41

viry escribió:
ola me gusto mas la pelicula 1 la dos esta muy aburrida losiento soy muy sinsera me gusta chad corbin blue y lucas grabeel troy no me me gusta bezitos
Fecha: 2007-11-23 16:58:45

karina escribió:
Fecha: 2007-11-23 17:47:19

luis escribió:
Me encanta high school musical y high school musical 2 mis personajes favoritos son ryan (lucas gabel) y sarpey (aley tisdaley)
Fecha: 2007-12-04 08:55:31

Fecha: 2007-11-23 20:09:06

EuGe escribió:
ola bueno nada poooohs k coloken mas foto de haigh school musical bueno xk me gusta muxo ami y a mi hermana poooohs y nda aki le dejo mi correo eletronico pa k me agregen pooohs ya xau cuidesen muxo aa y lo mejor es high school musical del mundo xau
Fecha: 2007-11-27 15:32:09

lautaro escribió:
hola me llamo lautaro i me encanta high shool musical 1 i 2 todos los actores son geniales algun dia me gustaria ser como ellos !!!! i vanessa por mas de que alla echo esas fotos tine que acer high school musical 3 porque sino no seria lo mismo .
Fecha: 2007-11-24 03:36:03

jimena escribió:
ps ami me encanta hsm los adoro vannesa eres muy guapa quisiera que vengan a españa a dar un concierto.eres guapicimo zac.tu y vannesa hacen una buena pareja me gustaria mucho que ustedes tengan hijos.I love zac
Fecha: 2007-11-24 12:52:46

andrea escribió:
troi estas reqete vueno dile a gabriela qe tiene una bos muy linda. TE TENDRIA QE GUSTAR LA GABRIELA!!!!! agregame troi plis a
Fecha: 2007-11-30 12:07:20

ester escribió:
hola me llamo ester y me gustais todos los wilcats sobre todo vannes y zac a y sabiais que tengo vuestro juego de la nintendo ds ya me e pasado todos los nivele con ayudaa de mi tio un saludo de una amiga mia que es una fan buestr que se llama julia y otro mio muchos besos de parte de ester y julia
Fecha: 2007-11-24 13:35:02

irene escribió:
la chica esta que esta con el del pelo ri- zado que es morenita me encanta su voz, su voz es primero alta y luego baja.
Fecha: 2007-11-30 12:21:52

yankarla escribió:
soy vuestra fan numero uno.sois mis idolos .mi familia vive en Bolivia y me gustaria que fuerais y dierais un concierto asi os conocerian y tendriais mas fans todavia .Bolivia esta en sudamerica yo soy de alli porfavor habladme os lo ruego un beso .yankarla
Fecha: 2007-11-30 12:53:56

naomi escribió:
me encanta hsm un monton soy su fan numero 1 y claro komo no el de zac efron k esta k te cagas de bueno ojala viniesen a benidorm me legraria tanto y seguro k iria y me pondria en primera fila komo no jejeje y las canciones super chulas me gusta la de hsm 2 bueno xao a los de hsm bye tkm zac efron
Fecha: 2007-11-30 13:31:00

fatima escribió:
yo eskribo esto pa troi y gabriela kk sois los mejore de todos sois los k mejores actuais i los mas wpos¡¡¡¡TROI ESTAS MUY BUENO DEMASIADO TKMM!!!!!!!!a mi me gusto mas la primera k la segunda pero n la segunda komo sale troi en bañador pues aun me gusta no slo me gusta por eso tambiem por komo actuais todos t sahrpei i trii no aceis buena pareja bueno eso es lo k keria decir espero k vengais a dar un koncierto pronta a alicante por favor acedme ese favvor plisss bssss OSKMMMMMMMMMM
Fecha: 2007-11-24 15:32:50

belenxu!! escribió:
zac tkm eres wuapisimo!! asley tus ejercicios d relajacion los mejores zac estas buenisimo m puedes dar tu msn si tienes tkiero muxo muxo muxo !tkmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm besitos! muak
Fecha: 2007-11-24 16:02:28

stefani escribió:
zac estas lindicimo dame tu msn vanessa eres espectacular tu y zac arian una bonita pareja loas adoro son mi grupo preferido tengo de ustedes los adoro los quisiera conocer o conoctarme con ustedes es mi gran sueño los amo bye stefani su fans
Fecha: 2007-11-24 20:44:25

sara escribió:
ashli sos re linda y quiro tu msn. te quiro a todos. chaaaaaaaaaaaaaaaaaaaaaaaauuuuuuuuuuuuuuu
Fecha: 2007-11-25 07:11:42

valentina escribió:
ashli sos hermosa te quiero mucho cantando sos genial banesa sos hermosa cantas hermoso te quiero
Fecha: 2007-11-25 07:36:33

kenedy escribió:
troy eres un papasito soy tu fans numero 1 ellas no son tus fans esas tontan nunca lo serian
Fecha: 2007-11-25 09:22:01

micaela escribió:
hola me encanta su pelicula los quiero a y pasenle esto atro toda dice el la escuela que el lucio pero el un tonto
Fecha: 2007-12-11 14:37:16

olaya escribió:
sharpay evans es guapisima tiene el mismo carazter que yo y en lo pijo me lo dices mis amigas que soy igual que ella pero tambien me gusta vanessa mi preferida SHARPAY
Fecha: 2007-11-28 11:43:58

pablo escribió:
troy eres un papasito soy tu mejor fans numero 1 de todo el mundo no como esa kenedy
Fecha: 2007-11-25 12:46:14

vanessa escribió:
Zac eres un papacito hermoso que guapo estas.ashley eres hermosa como vanessa.aa y lucas eres un paPACITO COMO ZAC BAY BAY .
Fecha: 2007-11-25 12:59:09

rosa maria escribió:
mi comentario es q hayga mas juegos de hi school musical 2 , videos ,conciertos,dibujos,etc gracias por cumplirlo
Fecha: 2007-11-25 13:10:31

Micaela escribió:
Hola soy fanatica de Zack Efron me encanta como hace la pelicula Sharpey es re linada en la pelicula 2 y en la 1 sale fea Gabriela en la 1 sale re linada y en la 2 sale fea chau
Fecha: 2007-11-25 13:32:46

lupita escribió:
Fecha: 2007-11-25 17:17:46

abigail escribió:
holaa!! les queria decir que me encantaron las peliss las dos!!!!!!!!!!! estubieron re buenas sobre todo ashley actuo re bien!! soy fanatica de ashley tisdale besos!!!
Fecha: 2007-12-03 11:17:08

victoria escribió:
HOLA me an encantado las dos pelis . troy esta buenisimo chao besos
Fecha: 2007-12-03 10:06:28

Rosangela escribió:
bueno zac efron esta buenisimo y en la pelicula hsm 2 mas todavia me encanto muchisimo hsm 2 espero que no saquen a vanessa por que sin ella no sirve y sin zac meno espero que me escribas porfavor, aah y los dos hacen una muy pero muy linda pareja me gusta muchisimo berlos a los dos bien juntos... chaitoooooo escribeme
Fecha: 2007-11-28 14:12:25

maider paloma ruiz pardiño escribió:
pues no se que desir que pongan mas juegos de high school musical 2
Fecha: 2007-11-25 22:06:27

Marina escribió:
Es el mejor programa y esque hay un chico que me gusta pero es un secreto solamente esque quiero decir que son los mejores personajes que han existido en toda mi vida
Fecha: 2007-11-30 13:39:51

-neniyah-kathy escribió:
zac y ashley son mis favoritos sois los mas guapos.Os quisiera conocer por que sois lo mas quiero que hagais mas pelis
Fecha: 2007-12-05 09:19:01

melina orellano escribió:
holaaaaaaaa los quiero mucho zac te amo y mi hermano ama a gabriella bueno chauuuuuuuuuuuuuuuuuuuuuuuuuuu
Fecha: 2007-12-05 09:55:55

Isabella Cháves escribió:
son espectaculares son de lo maximo troy esta bien bueno no se como enla pelicula de high scool musical 2 pudo abandonar a gabriela con sharpey....gabriela esta re bonita la mas hermosa de la pelicula saludes a sharpey,taylor,brayan me facina la pareja de troy y encantas troy+++++++++++.........chao me responden te amooooooooooo troy......chao gabriela estas hermosa en la pelicula......
Fecha: 2007-11-28 15:07:37

carla escribió:
bueno voy a empezar el juego espero que tenga suerte chau
Fecha: 2007-11-30 16:05:28

noraimy escribió:
amo a zack efron esta bello, pero pienso q deberia qdarse en la peli con sharpein y no con gabriella
Fecha: 2007-11-30 18:11:43

CESIA escribió:
Fecha: 2007-11-30 18:31:57

Ana escribió:
Q es bacan
Fecha: 2007-11-30 18:51:32

adnahir escribió:
hola me llamo adnahir y tengo 12 años yo se que todas quieren el msn de zac(troy) sharpey y todos ellos bueno agregenme yo los tengo a y una cosa muchas aqui son fans numero 1 de troy a nivel mundial bueno djenme decirles que yo soy la fans numero 1 a nivel universal jajaja. mentira vale muchos besos a todas
Fecha: 2007-12-05 11:32:16

nohelia karina rojas moreira escribió:
hola chicos como les va yo solo quiero conoserlos yo soy su idola numero 1 porfavor les pido que vayas al zapin zone para mandarme saludos y a mis amigas cielito alexsandra y eliana se los pido atentemente nohelia si idola numero uno y perdon por la ortografia ok al amo mucho
Fecha: 2007-12-13 13:02:53

idalia gisel escribió:
Me gusta mucho high schol musical 2 espero que agan la 3 hojala y si vaneza quisiera ser tu amiga mandame un correo vay vay
Fecha: 2007-11-30 23:02:06

clara escribió:
La peli es muy guai!!!!!! besitos!!
Fecha: 2007-12-03 11:24:20

andrea escribió:
Que no se valla vane es muy buena actriz y si a zac le gusta vanesa dejarlos.Por que son jovenes y yo y mi amiga lyan creemos que pueden hacer lo que quieran si no es en el plato.pero no tenes que despedir a vane por que sa disculpado y suplicado muchas vez.por favor que no se valla.adios zac te amo guapo bonico tio bueno
Fecha: 2007-12-03 11:42:00

Alixon Maria escribió:
Yo pienso que todos los que trabajan alli en esa pelicula sonsimpaticos,diertidos,bakanes...... Tambien que gabriela es la mas hermosa que hay con troy e sla mejor pareja sharpey con este se me olvido bueno todos son buenos pero la mej0or pareja es troy y gabriela BUENO ME DESPIDO CON UN GRAN BESO , ABRAZO , Y QUE SEPAN QUE SON UNOS BAKANES LOS AMOOOOOOOO MUUUUUUCHOOOOOOOO OKIS Y ESPERO QUE LEAN ESTE MENSAJE CON MUCHO AMOR Y CARI;O PARA TODOS LOS DE H.S.M. 2 LOS QUIERO BAY
Fecha: 2007-11-28 16:13:24

vanesssa escribió:
ola m llamo = k tu vanessa t tu "sarpei" tamien aces un pàpel k t kasas todos m encantais y e visto la peli 7 veces la 2 y la uno ni t kuento troy t kiero m voy os amo bsss bay
Fecha: 2007-12-05 12:00:45

javitha (javiera gonzalez) escribió:
hoy troy eres tan rico hermoso Precioso dile ala gabrilea que canta muy lindo me gustaria cantar con ella ya xao hermoso bello troyy mua un BESO muy grande te amo troyyy ta.ta.=) aioz... osea xao.........
Fecha: 2007-12-01 06:43:30

oigan en la escuela me dise troy y a una compañera gabriela y siempre nos molestan
Fecha: 2007-12-13 12:57:04

Dario Pazmiño escribió:
Hola Troy me gusta tu voz.Dile a Gabriela que canta muy lindo
Fecha: 2007-11-28 19:58:31

cristin karina escribió:
hola!!!!!!!! soy fan de hsm2
Fecha: 2007-12-01 08:53:11

cristin karina escribió:
mi correo es si ven mi correo agregenme por fis se lo pido par gabriela y troy
Fecha: 2007-12-01 08:59:32

zoe escribió:
quiro saber si hay high school musical3 y que si todos lo s protas estais bien .un beso zoe .vuestra admiradora favorita.
Fecha: 2007-12-01 10:06:03

Iratxe escribió:
Ola me llamo Iratxe keria felicitaros x la peli me a gustao muxo. Lo k mas me gusta son las kanciones, kuando vamos la kolegio siempre estoy con mis amigas kantando vuestras canciones. Sois los mejores|||||
Fecha: 2007-12-05 12:09:14

melina y daiana y solana escribió:
Fecha: 2007-12-01 11:29:11

andrea escribió:
ke onda kon lo ke vanessa y zac se separaron y tambien de ke se embicho la vanessa ke asco
Fecha: 2007-12-01 11:48:28

rodrigo escribió:
troy te pido que para higs scool musical 3 en argentina des autografos y juegos de ustedes ara peyteinton 2 zac tu numero 1 rodrigo
Fecha: 2007-12-05 14:17:20

maria paula escribió:
hola me encanto la peli y el beso fue lo mas bueno de todo la cancion de la cocina adios
Fecha: 2007-12-05 15:11:47

cristina escribió:
zac kiero k bengas a conocerme a murcia(blanca)
Fecha: 2007-12-05 15:19:22

lizeth2007 escribió:
HOLA chicos ustedes son lo maximo ,por que zack no sale en el concierto,hagan un concierto en Costa rica me muero por conocerlos los QUIERO chaoooooo
Fecha: 2007-12-01 13:41:37

brisa escribió:
hola troy sos el mejor me encanta como actuas chauuuuuuuuuuuu te doy mi
Fecha: 2007-12-02 05:59:06

brisa escribió:
hola troy sos el mejor me encanta como actuas chauuuuuuuuuuuu te doy mi
Fecha: 2007-12-02 05:59:49

jenny montalba gil escribió:
holi high school musical 2 a mi meencantan sus peliculas y yo le quiero mandar mucho cariños a zac efron a vanessa anne y a todos los demas pero mis compañeras del cole cada ves les gusta mas el zac efron y hay una amiga en el colegio y hace todos tus movimientos pero yo tengo todo el poster y me encanta s zac efron tu ere s el mejor me gusta all for one si quieres llamame mi numero telefonico es : 2796907 chicos de high school musical 2 todos pueden chatear con migo y ashley mis compañeras les encantas y le gusta el vestido de que de color celeste y mi correo es : chau se despide con cariño jenny montalba ... llamenme o chateencomigo chauuuuuuu...
Fecha: 2007-12-02 09:41:42

brenda soledad escribió:
hola!!! me encata high school musical ,,, los quiero un monton a zac, a vanesa , a ashey, a lucas , etc ... son unos genios para actuar y vos zan efron sos hermoso no hay nadamas que decir
Fecha: 2007-12-11 19:44:11

gabriela escribió:
holi son muy bkn los de high school musical 2
Fecha: 2007-12-02 10:47:44

grecia escribió:
hola high school musical son geniales me encanta cuando bailan,cantan me gustaria que me manden una foto de ustedes chau
Fecha: 2007-12-02 13:06:39

YASMIN escribió:
Fecha: 2007-12-11 21:00:12

beatriz marti beneyto escribió:
me gustaria q como me e agregado sus messengers q ablen . agregadme sobre todo ashley zac i vanesa, venir a visitar españa i el colegio la salle paterna agregadme
Fecha: 2007-12-02 14:19:22

ERIKA escribió:
Hola me gusta la peliculas las 2 tengolas canciones de las dos peliculas chau
Fecha: 2007-12-02 14:24:34

la fans de high school musical escribió:
hola! queria comentarles q me encanta soy la fans n° 1 lo siento a todas esas chiquititas q escribieron eso no digan cosas como yo soy la fans n 1 porq yo soy la fans n°1 y saben q? yo soy una divina total tengo mucho glamour en cambio ustedes son todas unas fieritas unas mamarruchadas bueno chau besos para hsm y sepan q yo soy la fan n°1 for ever bey
Fecha: 2007-12-05 17:33:43

Julieta escribió:
me gustaron mucho la 2 peliculas sobre todo la 2.tengo el cd de high school musical 2.sharpein me cay super bien y tailor y gabriella tambien.troll es muy guapo.
Fecha: 2007-12-02 16:57:27

diego alfonso escribió:
troy y gabriela quiero conocerlos en persona ustedes pueden venir para valencia???
Fecha: 2007-12-02 19:43:15

yordana escribió:
el sitio web esta copadisimo!!!!
Fecha: 2007-12-05 20:31:05

thiara esmeralda collao castillo escribió:
necesito buscar cosas para el messenger ded princesa cenicienta y la foto sea grandee
Fecha: 2007-12-12 08:33:39

aldana star escribió:
holasssss!!!les cuento de que yo soy re pero re fans de high scgool musical ok?byeeeeeee
Fecha: 2007-12-06 10:51:56

aldana star escribió:
hola troy me encantas sos re pero re lindo te doy mi metro po eso mmmmm!!! . bueeeee chau byeeeeeeee byeeeeeeeeeeeee!!!!!!!
Fecha: 2007-12-06 10:54:07

andrea ponce escribió:
ola troy que tal ?? yo bn soy los mejores yo tebgo la primera y la segunda y siempre las veo eres muy guapo pero tu pegas como novia a gabriela montez cojeme en tu mesenger o damele ok chao bssssssssssss
Fecha: 2007-12-06 12:36:48

mely escribió:
hola me gustaria participar en la peli pero ya la hicieron ah me dan sus msn? tkm Zac te amo
Fecha: 2007-12-06 15:06:42

julieta escribió:
hola chicos me encanta la peli soy su fan numero 1 amo a zac y me gustaria se sharpay es re cool como yo me encanta como se viste a raian es gay son lo mas los amo a todos besos juli
Fecha: 2007-12-06 17:01:23

ana laura escribió:
hola chicos me encanta zac y vane soy fanatic a numero 1 de zac y vane me encanta la pelicula high school musical 2 toda la pelicula
Fecha: 2007-12-06 19:44:11

paola escribió:
me muero por ti troy y mis amigas tambien espero que leas este mensaje me encantas muchoooooooooooooooo........
Fecha: 2007-12-06 21:05:55

agustina escribió:
hola a mi me encanto la peli y la 1 y la 2 vanessa y zac son los mejores y hacen la mejor pareja a zac a vos te gusta shasli disle contestame zac les mando un beso enorme chauuu lindos chau chau chau
Fecha: 2007-12-12 09:37:44

Sonia escribió:
me encanta High shool musical ES LO MEJOR TE KIEROOOO ZACCCC I LOVE YOUUU!!!!!!!!!!!!!!!!!!!!!!!
Fecha: 2007-12-07 04:17:15

FELIX escribió:
OLA SOY FELIX Y ME ENCANTARIA CONO CEROS TENGO UNA AMIGA LLamada laura qe le encanta hsm tiene todo lo qe haveis sacado bst cuidaros bye
Fecha: 2007-12-07 04:26:04

noryely escribió:
ola k tal? Bueno es una pena k vanessa ya no actue en + pelis de HSM pero bueno tanpoko le bendria mal por acer lo k a exo, aunke yo kreo k se an pasu un poko kn ella pobrecilla!!! Bueno Vanessa k sepas k k yo te apoyo un montonazo wapa tkm I love you zac te amo
Fecha: 2007-12-10 13:33:49

MIREIA Y CARLA escribió:
Fecha: 2007-12-07 09:54:08

Fecha: 2007-12-07 09:54:23

Fecha: 2007-12-07 09:58:37

macarena escribió:
buen me encantan las peli de high school musical . me encanta troy bolton(zac efron) es hermoso!!!!!!!!!!!! buen me voy despidiendo . chau
Fecha: 2007-12-07 11:19:18

macarena escribió:
buen me encantan las peli de high school musical . me encanta troy bolton(zac efron) es hermoso!!!!!!!!!!!! buen me voy despidiendo . chau
Fecha: 2007-12-07 11:19:19

geraldine escribió:
hola ami me gusta tus musicas y veo todos tus novelas mi pais es de peruu.................... amo atroy a charpe riayan gabrielamya todos etc y ahora tengo high chool music 2 chau
Fecha: 2007-12-07 15:17:34

camila rodriguez escribió:
Fecha: 2007-12-07 16:12:07

jaanettt escribió:
o0olaa zac etz.. zac me gustaria verte en persona me muero por conozerte tio estas como un tren
Fecha: 2007-12-07 17:07:48

florencia escribió:
hola soy florencia y quiero decir que high school musical 2 fue la unica pelicula que me gusto y por lo tanto es la unica que primera tambien la vi. tengo 11 años y quisiera que hagn otra.
Fecha: 2007-12-10 15:00:04

dahiana escribió:
hola me llamo dahia tengo 10 años y mi fans es gabriela porque es simpatica y muy guapa
Fecha: 2007-12-08 03:34:27

alba blanco romero escribió:
hola soy alba de hospialet de llobregat mis fans soys todos pero el que mas la sharppay,el troy i la gabri. Me gustan todas las canciones buestras os dejo mi msn por si algun dia me quereis hablar i estare encantada de conoceos:
Fecha: 2007-12-08 09:01:33

paula maza escribió:
hola soy paula.Me encanta hsm 1y2.Aguante Gabriella Montez!! que le ven de lindo a troy chicas?? :-P Yo nada, como se nota. Si quieren ser mis amigos agreguenmen:
Fecha: 2007-12-08 09:52:27

paula maza escribió:
hola soy paula.Me encanta hsm 1y2.Aguante Gabriella Montez!! que le ven de lindo a troy chicas?? :-P Yo nada, como se nota. aun asi me encantan todas las canciones!! Si quieren ser mis amigos agreguenmen:
Fecha: 2007-12-08 09:53:41

carola escribió:
me encanta high school musical 2,la mejor actriz me parece sharpay,soy su fan numero 1.
Fecha: 2007-12-13 13:55:12

lisi escribió:
Hola soy lisi tengo 10 años y que le ven de bue no a lucas gabriel el no es lindo el ma lindo es zac y esta super guapo.
Fecha: 2007-12-08 22:26:07

ana escribió:
yo soy la mayor fan de zac y de vannesa. me encantaria verlos en persona,seria un sueño
Fecha: 2007-12-09 05:12:10

mika escribió:
troy es re guapo hace linda pareja con gabriella jejeejejejej :P
Fecha: 2007-12-09 08:46:42

patricia escribió:
me encanta hsm y hsm y todo lo k trata de ellos sobre todo vanessa zac y ashley para ablar sobre hsm mi msn agregarme plis
Fecha: 2007-12-09 09:49:58

roxana belen escribió:
Hola ¡¡¡¡¡¡ yo soy roxana y me encanta zac soñie qe lo besabe des pues esimos sexso y tube un hijo con el chayto a y soy de argentina
Fecha: 2007-12-09 13:12:50

zaira escribió:
le quiero decir a zac que esta bien guapo y a vane que la admiro mucho.
Fecha: 2007-12-10 17:17:25

osita escribió:
hola yo quiero que venga high school musical a tehuacan para ver en persona a zac y annesa los quiero mucho y me se todas la canciones en ingle y español bey.
Fecha: 2007-12-10 17:55:35

Bàrbara escribió:
hola soy bàrbara y soy de argentina, me encanta zac es muy lindo y me encanta sus canciones me gustaria conocerlo personalmente pero solo es un suenochau.un beso a zac.
Fecha: 2007-12-09 16:40:35

michael david arenas peralta escribió:
me guesto high school musical y quiero ver la segunda parte en español
Fecha: 2007-12-10 18:47:12

saul escribió:
hola so saul quiero mandarles saludos a zac a vanessa a ashley a lucas a corbin y a monique espero que me contesten y me den su himel de zac y ashley adios y saludos a todos los de lo angeles california E.E.U.U.A.A.
Fecha: 2007-12-12 15:10:53

madelin escribió:
¡hola! cuando sea crande quiero ser como vanessa y pocieto vanessa y troy a sen una bonita pareja..........chao
Fecha: 2007-12-10 10:01:57

bueno a mi me enkanto la peli de high school musical 2 fue genial verla pues yo pienso ke todoas los personajes de esa peli son unos grnades famosos y siempre haroan cosas padres pero en algo yo no estoy deacuerdo y es ke:ZAC Y VANESSA SEAN NOVIOS no kedan zac keda kon otra chavamas bonita komo ashley tisdale.
Fecha: 2007-12-10 10:58:01

alexia escribió:
Hola a mi me encanto la peli la 1 y la 2 vanessa y zac son los mejores y hacen la mejor pareja
Fecha: 2007-12-10 11:30:43

gonzalo escribió:
hola la amo a vanesa
Fecha: 2007-12-13 08:33:04

yoali escribió:
te amo zac y quiero ser como vane
Fecha: 2007-12-12 21:14:53

valentina escribió:
NESESITO EL JUEGO DE HIGH SCHOOL MUSICAL!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Fecha: 2007-12-18 09:03:40

erika escribió:
me me encanta high school musical 2y1
Fecha: 2007-12-18 19:45:46

ROCIO AYRES escribió:
Fecha: 2007-12-17 07:01:37

blanca escribió:
me encanta high school musical es la caña¡¡¡¡ tengo 12 años y estoy enamorada de zac efron te mando un besazo mmmmmuuuuuuuaaaaacc tteeqquiieerroo mmmmmmuuuuuccchhhooooooooo
Fecha: 2007-12-14 02:54:57

Michelle escribió:
kiero decirles a todos los de disney channel k son muy buenos actuando sobre todo tu troy k estas buenisimo y cody y zack kiero decirte algo zack.........i love you y a ti cody te kiero bamos k los dos estais iwal de buenos los dos xou a todossssss
Fecha: 2007-12-14 06:15:55

maria laura escribió:
son lo mejor zac me gustaria conoserte y a gabriela te amo zac gabriela disen que mi prima se parese a ti zac espero que medes tu msm
Fecha: 2007-12-14 09:33:15

aracely escribió:
esta pelicula es la maxima y7 porfa mandenme el msn de sharpei y troill boltton porfis es lo lindoo!!!
Fecha: 2007-12-14 10:29:47

lolo escribió:
estan buensos los juegos de high shool musical
Fecha: 2007-12-18 10:26:30

Fecha: 2007-12-17 17:32:26

andrea nicole puell mori escribió:
a mi me gusta zac efron(troy bolton)y si alguien quiere ser mi amiga/o este es mi
Fecha: 2007-12-18 10:34:22

Michelle escribió:
ola kiero decirte codi k estas buenisimo y k me agreges a tu msn y todos los demas aunke no me entendais bueno mi msn es actuas muy bien con troy lo mismo digo para ti troy y me pregunto como se siente besando a troy tienes muxa suerte para besar a troy aaaaaa y un apregunta eres novia de troy escribime plis os espero en mi msn si me agregais bueno xou a todosss espero k aveis leido mi otro comentario bueno saludos de parte de Michelle a todos los actores y actrices de disney channel besos.dew...... CONTINUARA.
Fecha: 2007-12-14 11:10:27

Michelle escribió:
A una cosa he leido algunos comentarios y no em han gustado dicen k no les gusta high school musical 2 y tampoco los personajes pues para k lo sepais kiero deciros una cosa a mi me gusta high school musical 2 y mas los personajes a si k no os paseis okis dew a todos wapos
Fecha: 2007-12-14 11:14:14

Gloria escribió:
ami me encanta Zac Efron y Gabriella estan buenisimos los dos yo haria el amor con los dos
Fecha: 2007-12-14 15:30:09

andrea escribió:
amo ha zac efron y ha vanessa son lo mejor y cool
Fecha: 2007-12-14 16:17:16

naomi escribió:
sy fanatica de high school musical 1 y 2 mi personaje que mas me gusta en vanesa y siempre canto high school musical 2.
Fecha: 2007-12-14 17:50:26

jade escribió:
Fecha: 2007-12-17 19:40:43

lizbeth escribió:
ola quiero desir q adoro high school musical me encanta la peli 1 y la 2 achley me encanta como actuas tambien lucas, monic, vanessa, zac y por ultimo corbin me caen muy bien sigan asi y un saludo para todos los de zz y disney chanel
Fecha: 2007-12-14 20:00:35

MIRIAM escribió:
Fecha: 2007-12-14 22:22:51

beatriz noblejas (toledo) escribió:
me encanta high school musical soy una fans genial me estoy combertiendo en la fans nº 1 de high school musical (troy wapisimo ) ( gabriella muy wapa ) quiero ke disnei channel sake ala venta un mogollon de pelis de hing school musical pero no tan segidas porke si no pasara lo mismo k con harri potter y ke por favor troy en la proxima troy salga con melenita gusta más al publico kien este de acuerdo con migo conectaros con PORFAVOR LEANLO
Fecha: 2007-12-15 05:05:38

celeste escribió:
hola chicos bueno nada solo les queria decir que las peliculas 1 y 2 de high school musical esta rre copa bueno nada un beso y aca les mando mi email un beso celes
Fecha: 2007-12-15 09:21:19

elizabeth raquel escribió:
ta pule a mi correo es que dios los bendiga jajajaja
Fecha: 2007-12-15 10:17:59

nere escribió:
me encanta high school musical 2 porq me gustan como bailan ,cantan y actuan son los mejores gracias
Fecha: 2007-12-15 10:35:38

andrea escribió:
ustedes son o maxcimo los qieros mucho sigan adelante los qiero high school musical 2y saludos a gabriela troy scharpey teylor chad y brayan saludos a todos
Fecha: 2007-12-15 11:23:20

shirley escribió:
hola soy shirley te qeremos high school musical 2 mihermana los adora saludos a gabriela troy scharpey y teylor y chad y brayan muchos saludos
Fecha: 2007-12-15 11:30:12

julieta fratesi escribió:
Fecha: 2007-12-15 12:08:32

carmen maria escribió:
Soys el mejor grupo:Grabiela te adoro y k cantas muy bien;Troyl te amo me encantas como actuas bueno adio troil y grabiela adio os kiero muxo carmen maria
Fecha: 2007-12-18 12:23:00

btre escribió:
te amo troy
Fecha: 2007-12-15 12:33:07

fatima l. escribió:
me encantas troy gabriella haces una linda pareja con troy besos a todos
Fecha: 2007-12-15 12:51:41

ANDREA escribió:
-hola soy andrea i me gusta mucho high school musical 2 i la grabiella es mi faborita i el troy claro os quiero mucho besitos adios
Fecha: 2007-12-15 15:16:12

erika lopez escribió:
ashley tisdale ers suuuuuuuuuuuuuuuper bella soy tufan numero uno soy la que siempre te manda coreos saludos desde la ciudad de guatemala chaoooooooooooooooooooooooooooooooooooo a todos los de high school musical zac,vanessa,corbin,monic,lucas,ashley bye todos ustedes son suuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuper geniales y troy eres super lindo. bye,bye
Fecha: 2007-12-18 13:48:27

irene escribió:
amo a troy quisiera que el fuera mmi novio
Fecha: 2007-12-15 16:29:27

katherin alejandra rendon camacaro escribió:
hola me llamo katherin y soy de anaco bueno a mi me gusta mas high school musical por que son los mejores y mi favoritos es zac efron,lucas,vannessa,sharpei,corbin y monique bueno todos lo amo t.q.m pero a zac mas te amo zac
Fecha: 2007-12-15 18:24:10

solange escribió:
hola grabiela soy tu hermana mama papa no te disen q soy ru hermana mayor estoy en peru callao
Fecha: 2007-12-15 19:03:07

jeniree perez escribió:
Fecha: 2007-12-15 19:34:47

lucia rodriguez escribió:
hola como te va desde que te vi actuar en television supe que ivas a ser la mejor de todas vos vaneza sos la novia de zack y el es re buen actor como vos donde aprendieron a cantar de esa forma?los quiero a todos inclusive a lucas corbin ahsley y a todos los demas los reeeeee quiero besos
Fecha: 2007-12-15 19:39:39

L@UR@ escribió:
yo pienso qe zac efron es muy lindo esta guapisismo quien lo quiera ami bebe hermoso tattttatttatat hermoso bueno y quiero qe hay juegos de cantar donde nosostros eligamos la cancio el vestuario y el escenario donde elllos canten bueno esta es mi opinion ojala qe les guste bye
Fecha: 2007-12-19 21:10:32

florimar escribió:
Hola soy de maracaibo y esta pag es buena por una parte
Fecha: 2007-12-16 12:35:28

SANDRA escribió:
hola me llamo sandra y adoro high school musical.tengo poster,album,camiseta,libro pelis y mas cosas y x supuesto :¡e idoa hsm en ice tour!¡ES SUPER DIVERTIDO MERECE LA PENA IR!
Fecha: 2007-12-16 13:51:29

VANESSA escribió:
hsm soi los mejores y aunk no leais este mensaje soys waos y suprmajos .me muro x conoceros .muxsbesos vanessita
Fecha: 2007-12-16 14:14:17

ricardo escribió:
hola me encanta disney chanel lo veo todos los dias es muy entretenido y me encantari conoser a lo chicos de high school musical
Fecha: 2007-12-16 15:33:07

gabriella montez escribió:
troy mihito rico t q ene kaleta y la gabriella y bonita pero la sharpay es fea y la odio chaooooooooooooooo¡
Fecha: 2007-12-16 15:53:49

adrian de leon escribió:
me gusta sus peliculas
Fecha: 2007-12-16 17:12:55

yenifer escribió:
hola!!!!!!!!!!! encanta la peli un besote enorme para zack que lo amooooooooooooo yeni!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Fecha: 2007-12-16 18:26:24

J@VIER@ P@Z escribió:
yo adoro ha zac efron (troy bolton) y si alguien quiere ser mi amigo/a este esmi email: C.H.A.O
Fecha: 2007-12-16 20:40:39

andrea escribió:
a la niña que se llama marta, i que aya puesto "soy la mejor fan de zac efron" pues se equivoca por que soy yo la mejor fan de zac efron, bueno de todo el grupo de high school musical. a por cierto, yo soy la prima de zac efron. os chinchais idiotas, pringados...
Fecha: 2007-12-21 11:54:13

maria jesus escribió:
hola!!!!me encatan high school musical 2 a mis primo le encanta verlos como a mi mis primoa se llaman maxi y tomi son hermanos mi email besote los quiero.
Fecha: 2007-12-20 09:39:14

ana escribió:
holi a mi me gusta la peli de high school musical, hogala q daran high school musical 3 eso no mas xuuuuuuuuu anita
Fecha: 2007-12-20 16:32:09

zugehy escribió:
mira yo quisiera concera troy y a gabriela son estupendos yo loa admira ufffffffffff demasia se me cuidan mucho . pr fas respondeme este mensaje a y agregame baaaaaaaaaaay un beso par todos
Fecha: 2007-12-20 10:22:53

camila maribel escribió:
hola amigos de high scool los felicito`por el exito........ zac efron te amo sos genial vannesa sos lo mas mucha suerte........ camila
Fecha: 2008-01-03 08:21:46

daniela escribió:
hola high school musical quiero decirles que soy su fans numero 1
Fecha: 2007-12-20 12:01:00

noelia escribió:
hola soy noelia me gusto mucho la 1ºpelicula pero la que más me gusto fue la 2ºpelicula.Os dejo.
Fecha: 2007-12-20 12:09:53

miriam escribió:
me gusto mucho la 1º pelicula pero me gusto más la 2º la he visto por lo menos 8 veces, me encantan las canciones , bueno adios un beso.
Fecha: 2007-12-20 12:11:18

vanessa escribió:
ustedes son los mejores zac eres un bonbon todos ustedes son ingreible vanessa eres supre linda a todos son mis preferidos me encanta como lo protagonisan les mando un beso a todos los quiero bey.
Fecha: 2007-12-20 12:20:16

claudia escribió:
hola me encanto la pelicula tambien me gusta las canciones y los bailes mis canciones faboritas son todas.........()
Fecha: 2007-12-20 20:14:56

JeIsOn escribió:
Fecha: 2007-12-20 12:26:52

atuu escribió:
vanessa (gabriela) eres muy linda y troy eres precioso tambien me gusta como es sharpay pero es muy mala con gabriela quiero que agan una nueva peli chaoooo
Fecha: 2007-12-20 13:50:26

aldana escribió:
hola high cschool como andan las pelis copadicimas loa cds lo mas y yo the best bueeee dejo saluditos para TODO BAYBAY AGUANTE GOOGLE TODO LO QUE NECESITO TA AY GRACIAS POR TODO SERGIO TE AMO ALDANA
Fecha: 2007-12-20 13:55:46

genesis escribió:
hola me encanto hsm 2 y la 1 tambien quiero conocerlos y hablar con ustedes los quiero
Fecha: 2007-12-20 14:11:49

maria escribió:
osea me gusta mucho high school musical tengo todo lo de high school musical la manta la cortina la almuada el sofa etc. bueno i lo qe e gusto mas fuegabriela creo que te voi a quitar a troy porque esta bien guapo a todos los chavos les mando saludos diganle de mi parte a sharpey bueno e visto todas las peliculas i me an gustado muchoooooooooo
Fecha: 2007-12-31 15:25:43

super escribió:
high school musical mola un monton ppues a mi y amis amigas troy nos vuelbe locas porque es el mas guapo del mundo
Fecha: 2008-01-03 10:11:58

sabrina escribió:
hola hola !!!!!!! como les ba escribanmee jejeje solamente pasabaa heyy son buenisimos ooook??
Fecha: 2007-12-21 18:27:16

ana escribió:
me encanto la segunda pelicula, en la tercera parte me gustaria que hubiese algo mas entre gabriela y troy y tambien chad y taylor besos
Fecha: 2008-01-01 05:35:40

Miriam SL escribió:
Bueno a mi me encanta high school musical 1-2, bueno no he visto la peli 1 pero la dos si.Miren en pones tomas falsas de high school musical 1-2 de Zac y te sale un monton de gracia de Zac me rio un montonazo bueno a mi me gusta mucho las canciones y a mi me gusta a Ryan me encanta.. Adios.
Fecha: 2008-01-01 06:32:29

KARINA escribió:
Fecha: 2008-01-01 11:14:42

oooh thogether very good
Fecha: 2008-01-01 11:15:09

Troy Bolton escribió:
hola chicos y chicas. yo tambien os kero muxo.atuu gracias por el detalle de que soy precioso.estamos pensando en rodar High School Musical 3. XAO ADMIRADOREES. OS QUIERO UN MONTONAZO (traducido)
Fecha: 2007-12-22 08:51:12

Sofii escribió:
hola soy sofi los qiero los amo te quiero mucho high scool musical 2 los amo mucho son mis mejore amigos que tube en la vida son re quete bueno yo queria trabajar con ustedes pero bue¡ no pude porque soy chiquita tengo 6 años y ustedes tienen como 15 o 16 años asi que ustedes son los mas grandes porque ahi no trabaja ningún chiquito que tenga 6 o 5 años ya se que no puedo bueno me voy chau
Fecha: 2008-01-08 10:30:35

mateo escribió:
hola soy mateo y me en canta high school musical 2
Fecha: 2007-12-22 08:57:53

ana escribió:
troy estas como un tren
Fecha: 2008-01-02 12:31:44

Valeria escribió:
hola me rre gusta High School Musical soy re fans tengo su albun y su cidid soy la numero 1 de fasn
Fecha: 2008-01-03 12:53:57

Sofii escribió:
hola soy sofi los qiero los amo te quiero mucho high scool musical 2 los amo mucho son mis mejore amigos que tube en la vida son re quete bueno yo queria trabajar con ustedes pero bue¡ no pude porque soy chiquita tengo 6 años y ustedes tienen como 15 o 16 años asi que ustedes son los mas grandes porque ahi no trabaja ningún chiquito que tenga 6 o 5 años ya se que no puedo bueno me voy chau
Fecha: 2008-01-08 10:30:36

Sofii escribió:
hola soy sofi los qiero los amo te quiero mucho high scool musical 2 los amo mucho son mis mejore amigos que tube en la vida son re quete bueno yo queria trabajar con ustedes pero bue¡ no pude porque soy chiquita tengo 6 años y ustedes tienen como 15 o 16 años asi que ustedes son los mas grandes porque ahi no trabaja ningún chiquito que tenga 6 o 5 años ya se que no puedo bueno me voy chau
Fecha: 2008-01-08 10:30:37

sandra escribió:
hola me llamo sandra y soy fan numero 1 de high school musical y de high school musical 2
Fecha: 2008-01-01 15:32:22

Cristina Iris Beatriz escribió:
Fecha: 2007-12-22 17:06:25

soledad escribió:
Amo a Sac Efron
Fecha: 2008-01-01 18:45:52

karen alicia escribió:
la verdad me encantan los juegos de high school musical es algo super padre y me gustaria que pusieran varios juegos divertidos bueno ¡bye! @licia
Fecha: 2008-01-01 19:03:38

Stella Mª escribió:
Me gustaria que me mandarais la foto de Troy y Gabriela. Tengo vuestra pelicula La pelicula de High School Musical y vuestro concierto. Adios Un beso de vuestra amiga Stella Maria jimenez gomez
Fecha: 2008-01-08 09:14:16

katty escribió:
ola amix de high shool musical son lo mximo tienen la mejor musica y qisas no les inporte una simple opinion.
Fecha: 2007-12-22 17:47:29

Raquel escribió:
Fecha: 2007-12-22 17:55:04

ANA PIÑON escribió:
Zac Efron yo te quiero eres genial Vanesa tengo tu CD Ashley siempre te veo en hotel dulce hotel Monique Corbin y Lucas tambien sois geniales ha!!! Ashley y Lucas me encanto la cancion de UMUUMUNUKUNUKUAPUA"A y la cara que puso Troy fue graciosisima UN BESO A TODOS A TI TAMBIEN KENY CHAO ASTA PRONTO CHICOS/AS CON CARIÑO BUESTRA FAN Nº1.
Fecha: 2008-01-03 10:33:12

bien chicos es divertido jugar con ustedes bye saludos a todos lo quiero mucho vengan pronto a peru a piurabye me mandan entradas ok me mandan 26 entradas si profis mi direcciones : vicus b-17 departamento304
Fecha: 2007-12-22 18:01:51

Fecha: 2007-12-22 18:35:03

jacksiry ysayana avilez lopez escribió:
holas amigos de high school musical .los felicito por la peli esta muy chida me gusto mucho gabriela creo que te voi a quitar a troy porque esta bien guapo a todos los chavos les mando saludos diganle de mi parte a sharpey que no sea enojona ni que mende a su hermano a espiarlos jajajaja los quiero .bay....
Fecha: 2007-12-22 22:46:34

talia escribió:
ola soy talia y os qiero deciros a todos q me encantais y q sigais adelant q lo aceis muy bien bueno un saludo adios!!!!
Fecha: 2008-01-02 08:24:15

camila sierralta escribió:
ya:::: me encanta high school musical 2 y a la ashley tisdale la odio y me encanta la vanessa aun que haga esas cosas desnudas y zac con la vane asen buena pareja muy buena pareja y ojala que nunca se separen y dejen todo atras y empiezen de 0000 y sera mejor y ya cache a la ashley esta selosa y ahora que terminaron osea la ashley con zac mejor eso los kero muxo [xoxo-los kero muxo] my msn por seaca es ( pd: oye si keren que la vane no este con zac por lo que hiso la vane son puras cosas de niña encerio yo se toda la vida de la vanessa la se toda
Fecha: 2008-01-02 10:35:18

Valeria escribió:
hola me rre gusta High School Musical soy re fans tengo su albun y su cidid soy la numero 1 de fasn
Fecha: 2008-01-03 12:54:05

ANGIE escribió:
Fecha: 2008-01-02 15:31:18

Javier escribió:
high school musical las dos peliculas fueron de lo mejor y los pasaos de los bailes imcreibles,high school musical me encanta
Fecha: 2008-01-03 13:05:50

Sofii escribió:
hola soy sofi los qiero los amo te quiero mucho high scool musical 2 los amo mucho son mis mejore amigos que tube en la vida son re quete bueno yo queria trabajar con ustedes pero bue¡ no pude porque soy chiquita tengo 6 años y ustedes tienen como 15 o 16 años asi que ustedes son los mas grandes porque ahi no trabaja ningún chiquito que tenga 6 o 5 años ya se que no puedo bueno me voy chau
Fecha: 2008-01-08 10:30:12

Fecha: 2008-01-02 18:45:44

CAMILA escribió:
Fecha: 2008-01-02 18:50:48

maria tereza escribió:
megusta mucho todos los chicos del elenco de hai scool music son muy padres los quiero mucho
Fecha: 2008-01-02 20:34:58

hola chabos como anpasado la navidad............
Fecha: 2008-01-02 21:32:08

Irene escribió:
sois guapisimoss todos y la gente dice q es una chorrada pero yo no digo eso soys chulisimos y actuais genial a mi prima y a mi hermana les encanta Zac pero yo os amo a todos por que ninguno me caeis mal todos me caeis genial.Y a mi amiga nadamas le gusta Lucas pero ami me gustan todos.Wapisimossssssssssss y wapisimassssssssssss.Chao besos.
Fecha: 2008-01-03 05:22:01

Noelia escribió:
son todos guapisimos i guapisimas i quien no lo haiga visto que lovea High School Musical i High School Musical 2 disfrutas mucho es muy divertida para todas las edades os quiero mucho dew chau muchos besos!!!!!!!!!!!
Fecha: 2008-01-03 06:02:11

ronny escribió:
me gusta mucho high school musical 2 y espero que salga al aire la palicula high school musical 3
Fecha: 2008-01-03 14:44:11

Sofii escribió:
hola soy sofi los qiero los amo te quiero mucho high scool musical 2 los amo mucho son mis mejore amigos que tube en la vida son re quete bueno yo queria trabajar con ustedes pero bue¡ no pude porque soy chiquita tengo 6 años y ustedes tienen como 15 o 16 años asi que ustedes son los mas grandes porque ahi no trabaja ningún chiquito que tenga 6 o 5 años ya se que no puedo bueno me voy chau
Fecha: 2008-01-08 10:30:37

shirel escribió:
high school musical
Fecha: 2008-01-03 16:44:19

carolyn escribió:
hola mi nombre es carolyn y me gusta mucho high school musical 1,2 y espero con anciosa la numero 3 chau
Fecha: 2008-01-03 16:52:52

claudia escribió:
hola zac,vanessa,ahsly,lucas,monique y corbin.. mi nombre es claudia me gusta mucho high school musical 1,2 y me gustaria que hubiese high school musical 3 para ti troy,gabriella,sharpay,ryan,chad y teylor mi msn es mi prima julissa y magdalena son tambien fanaticas de ustedes de juli su msn es los queremos las 3.
Fecha: 2008-01-03 18:04:34

Sofii escribió:
hola soy sofi los qiero los amo te quiero mucho high scool musical 2 los amo mucho son mis mejore amigos que tube en la vida son re quete bueno yo queria trabajar con ustedes pero bue¡ no pude porque soy chiquita tengo 6 años y ustedes tienen como 15 o 16 años asi que ustedes son los mas grandes porque ahi no trabaja ningún chiquito que tenga 6 o 5 años ya se que no puedo bueno me voy chau
Fecha: 2008-01-08 10:30:39

isabel escribió:
la pelicula es lo mejor me encanta me alegro y que tengan existo bay bay
Fecha: 2008-01-03 18:35:43

Sofii escribió:
hola soy sofi los qiero los amo te quiero mucho high scool musical 2 los amo mucho son mis mejore amigos que tube en la vida son re quete bueno yo queria trabajar con ustedes pero bue¡ no pude porque soy chiquita tengo 6 años y ustedes tienen como 15 o 16 años asi que ustedes son los mas grandes porque ahi no trabaja ningún chiquito que tenga 6 o 5 años ya se que no puedo bueno me voy chau
Fecha: 2008-01-08 10:30:41

diana laura escribió:
Fecha: 2008-01-03 19:28:23

Sofii escribió:
hola soy sofi los qiero los amo te quiero mucho high scool musical 2 los amo mucho son mis mejore amigos que tube en la vida son re quete bueno yo queria trabajar con ustedes pero bue¡ no pude porque soy chiquita tengo 6 años y ustedes tienen como 15 o 16 años asi que ustedes son los mas grandes porque ahi no trabaja ningún chiquito que tenga 6 o 5 años ya se que no puedo bueno me voy chau
Fecha: 2008-01-08 10:30:44

Sofii escribió:
hola soy sofi los qiero los amo te quiero mucho high scool musical 2 los amo mucho son mis mejore amigos que tube en la vida son re quete bueno yo queria trabajar con ustedes pero bue¡ no pude porque soy chiquita tengo 6 años y ustedes tienen como 15 o 16 años asi que ustedes son los mas grandes porque ahi no trabaja ningún chiquito que tenga 6 o 5 años ya se que no puedo bueno me voy chau
Fecha: 2008-01-08 10:30:26

Malena escribió:
Fecha: 2008-01-08 12:16:37

laura ranea escribió:
mi madre dice que soy muy pesada con high scool musical pero me da igual las mas guapas son gabriela y sharpay y troy esta muy bueno
Fecha: 2008-01-08 12:49:51

sara escribió:
Fecha: 2008-01-08 13:12:40

andrea escribió:
high school musical es lA MJ peli k VISTO soy 1 de sus MAYORES FANS. Adoro a ASLY ,mencanta como ace de SHARPAY tambien a VANE,ZAC,CORBIN,TAYLOR y LUCAS.muchos BSOS.
Fecha: 2008-01-04 09:35:25

wilson escribió:
que est{a bien bacan que las chicas estan muy buenasas
Fecha: 2008-01-04 09:39:39

jime escribió:
hola soy jimena y estoy feliz de high school miusical ojala aparesca la '3' y muchas masss bessosss _JIME_
Fecha: 2008-01-08 13:17:52

jime escribió:
hola soy jimena y estoy feliz de high school miusical ojala aparesca la '3' y muchas masss bessosss _JIME_
Fecha: 2008-01-08 13:23:03

carmen maria escribió:
high school musical 2 es fantastico saveis nosotros los de mi clase la vimos y y cimos el baile en las vacaciones de navidad.adios jajajajajajajajajajajajjjjjj jejejej jijij soys los mejores del mundo.pero adios
Fecha: 2008-01-04 10:01:04

sara,dina e Ismael escribió:
YO QUISIERA DECIRLE A ZACK QUE ES MUY GUAPO Y CREO QUE MAJO.Y A VANESA QUE A ESTADO MUY MAL LO QUE HIZO CON LO DE LAS FOTOS. ESPERO QUE LA ADMITAN EN HIGH SCHOOL MUSICAL 3.GRACIAS .ADIOS.SUMI_SARITA7@HOTMEIL.COM.zac agregame. dina-hola zac eres encantador te admiro mucho te doy mi msn para que me agregues gracias por hablar con migo. vanesa eres muy guapa gracias por hablar con migo te quiero mucho chao.Hola soy Ismael y prefiero la primera pelicula,because la segunda era menos buena.¡NOS ENCANTA HIGH SCHOOL MUSICAL!CHAO.
Fecha: 2008-01-08 13:32:05

JULIAAA escribió:
A mi m da iwal hig school musical,lo k kero es kasarme kon corbin bleu!!!..........
Fecha: 2008-01-04 10:08:39

Sofii escribió:
hola soy sofi los qiero los amo te quiero mucho high scool musical 2 los amo mucho son mis mejore amigos que tube en la vida son re quete bueno yo queria trabajar con ustedes pero bue¡ no pude porque soy chiquita tengo 6 años y ustedes tienen como 15 o 16 años asi que ustedes son los mas grandes porque ahi no trabaja ningún chiquito que tenga 6 o 5 años ya se que no puedo bueno me voy chau
Fecha: 2008-01-08 10:30:35

nicole escribió:
Champey eres tu mi favorita eres tan bella q digo q tu soy yo te amo nicole
Fecha: 2008-01-04 15:15:59

sara elida morales ochoa escribió:
me gustaria que hubiera un juego donde crearamos la ropa y el look de los personajes
Fecha: 2008-01-04 19:46:20

sara elida morales ochoa escribió:
me gustaria que hubiera un juego donde crearamos la ropa y el look de los personajes
Fecha: 2008-01-04 19:46:21

sara escribió:
me gustas mucho roberto espero que algun dia me agas caso te quiero bye
Fecha: 2008-01-04 19:50:42

luis escribió:
troy es el mejor si ubriran juegos de los personajes me quedaria a troy
Fecha: 2008-01-05 07:25:22

ailyn escribió:
mmm...pues creo que high schol musical esta wenisima espero que las pelis llegen hasta la 10.000 por que no puedo dejar deverlas cuando la dan en disney,y lo mas raricimo fue el desnudo de gabriella me estraño mucho bueno uno nunca sabe todo de las estrellas bueno xauu y un beso a todos
Fecha: 2008-01-08 16:26:07

ailyn escribió:
mmm...pues creo que high schol musical esta wenisima espero que las pelis llegen hasta la 10.000 por que no puedo dejar deverlas cuando la dan en disney,y lo mas raricimo fue el desnudo de gabriella me estraño mucho bueno uno nunca sabe todo de las estrellas bueno xauu y un beso a todos
Fecha: 2008-01-08 16:27:04

caren.c. y priscila.m. escribió:
hola chicos como andan.amamos a zac y a vanessa.los adoramos a ashli y a lucas.besitos.caren y pri.
Fecha: 2008-01-05 18:12:11

angie escribió:
zac eres muy juapo quisiera ver a high eschool musical en guatemala en la capital shley eres muy linda quisiera conoser a todos ustedes en persona estoy ansiosa por conoserlos zac mandame un mensaje para saver sivas a venie o no pero ven porfabor te lo pido zac com tus amigos de high eschool musical temando muchos vesos cuidate mucho te espero chau
Fecha: 2008-01-08 17:46:15

leyre betore escribió:
a mi lo que mas me a gustado son los personajes y la peli;la decoracion a estado fantastico muy bonito.gabriela y troy son los que mas mean gustado o tambien vanesa y zak efron son sus berdaderos nombres.
Fecha: 2008-01-06 03:49:39

debi escribió:
A mi me encanta high school musical !!!! me la he visto las dos peliculas mas de dos veces y tengo los 2 cds k han sacado me encantaria conocer a zac y vanessa
Fecha: 2008-01-06 09:48:41

pablo escribió:
cuando yo vi high school musical 2 me encanto y me emocione tanto ke me baje el disco.para mi cantais fenomenal os lo prometo y soy buestro fans jeje jaja.bsss a high school musical
Fecha: 2008-01-06 10:12:57

pablo escribió:
ola yo otra vez eske me encata decir cosas.bueno para mi sherpey es wapina y es muy modernilla jeje,pero me gusta mas vanessa=gabriela ke es muy wapa y esta buenisima jajaja.bueno ya os dejo adios xao bsss a y troy juegas fenomenal al baloncesto jeje bsss
Fecha: 2008-01-06 10:17:32

sofia escribió:
saquen mas juegos nuevos
Fecha: 2008-01-06 12:40:40

paula escribió:
zac te re amo sos el mejor tengo 11 años pero si tuviera 17 me encantaria que seas mi novio sos hermoso y te mereces tener mucho exito tanto como tus amigos de high school musical.sueño con casarnos.te amo besos grandes paula
Fecha: 2008-01-06 14:35:06

alaina escribió:
HOLA me encanta high school musical porque esta el zac efron. espero comunicarnos con ustedes les dejo mi correo electronico te amo zac, quieres mi amigo
Fecha: 2008-01-06 17:11:08

gaby y belu escribió:
hola me encanta high school musical porqe esta zac efron y ashli son lo mas
Fecha: 2008-01-06 17:58:18

MARU escribió:
Fecha: 2008-01-06 18:21:40

ANA MARÍA escribió:
Fecha: 2008-01-06 18:32:48

rocio escribió:
hola la peli esta re buena y zac sos re lindoooooooooooooooooo¡¡¡¡¡¡¡¡¡¡¡
Fecha: 2008-01-09 14:13:58

rocio escribió:
hola la peli esta re buena y zac sos re lindoooooooooooooooooo¡¡¡¡¡¡¡¡¡¡¡
Fecha: 2008-01-09 14:14:00

rocio escribió:
hola la peli esta re buena y zac sos re lindoooooooooooooooooo¡¡¡¡¡¡¡¡¡¡¡
Fecha: 2008-01-09 14:13:55

rocio escribió:
hola la peli esta re buena y zac sos re lindoooooooooooooooooo¡¡¡¡¡¡¡¡¡¡¡
Fecha: 2008-01-09 14:13:56

ANA KAREN escribió:
Fecha: 2008-01-06 18:59:55

fran escribió:
me encanta gabriella
Fecha: 2008-01-09 08:12:21

fran escribió:
mi actriz faborita es jamie linn
Fecha: 2008-01-09 08:16:34

victor escribió:
hola medamo victor
Fecha: 2008-01-09 11:27:12

carolina isabel escribió:
me encanta high school musical la que me gusta mas es la sharpie
Fecha: 2008-01-09 11:33:39

darian escribió:
hola chicoscomo estan... les escribo para que sepan que los quiero mucho sobre todo a troy y a gabriella... cuidense mucho.. y sepan que siempre les cerre.. besos los quiero mucho y los amo.
Fecha: 2008-01-09 12:31:18

nadia escribió:
sharpey eres guapisima la mas guapa
Fecha: 2008-01-07 09:42:06

yesenia mabel escribió:
HOLA zac y vanessa zac saves yo tambien me llamo vanessa yo con vanessa somos lindas
Fecha: 2008-01-07 10:06:45

belen escribió:
oye ustedes hsm2 escribanme ok la vanessa es mas fea
Fecha: 2008-01-07 11:03:29

orne escribió:
holiiiiiii me llamo orne me encanta high eschool musical tengo las 2 pelis bueno zac ,corbin y lucas los amo y a las chicas las re quiero son re simpaticas bueno me voy chauuuuuuuuuuuuuu zac te re amoooooo
Fecha: 2008-01-10 09:05:57

nayara escribió:
hola me llamo Nayara a mi me encanta high school musical 2 porque es my programa favorito y Zac eres un mogoñon de wapo y vannasa tu cantas de una manera increible que nadie lo haria y vannesa eres un mogoñon de guapa yo quisiera ser como tu y no lo puedo ser un beso muy grande para todos y una mas grande para zac
Fecha: 2008-01-10 10:21:11

fernanda escribió:
hola soy fernanda y me encanto la peli hsm 2 esta muy buena xauuuuuuuuuu saluditos
Fecha: 2008-01-07 13:18:53

Sofii escribió:
hola soy sofi los qiero los amo te quiero mucho high scool musical 2 los amo mucho son mis mejore amigos que tube en la vida son re quete bueno yo queria trabajar con ustedes pero bue¡ no pude porque soy chiquita tengo 6 años y ustedes tienen como 15 o 16 años asi que ustedes son los mas grandes porque ahi no trabaja ningún chiquito que tenga 6 o 5 años ya se que no puedo bueno me voy chau
Fecha: 2008-01-08 10:30:35

belen escribió:
ola soy belen me encanta high school miusical y quiero que me deis vuestro mns porfa dew os quiero sois mis fans dewwwwwwwwwwwwwwwwwwww wapooooooooooooooooossssssssss wapassssssssssssssssssssss
Fecha: 2008-01-07 14:41:41

vera alberto escribió:
hola me encanta high school musical pero yo amo a zac efron vesos.
Fecha: 2008-01-07 16:58:47

Ale escribió:
zac efron estas bn guapo la verdad eres mi "honey" tkm todos actuan mui bn. Sigan asi todos. Ojala un dia los vea porfa vengan a mexico m gstaria muxo bueno bye se cuidan tods besos.
Fecha: 2008-01-08 21:47:03

JOHLIN escribió:
Fecha: 2008-01-07 19:43:48

rolanda angelina escribió:
hola me gusta la parte cuando troy y gabriela se besan fue muy linda que e visto en toda mi vida sii. troy ases buen papel y tu tambien gabriela. ustedes para siempre siiiiiiiiii para:troy y gabriela. de:rolanda
Fecha: 2008-01-10 18:00:40

nayara escribió:
hola atodos los de high scool musical 2 yo soy otra vez nayara para decirles que son los mejores de Disney channel les digo esto por que son los mejores vannesa eres la mejor un besote para todos muy grande y muy grande Nayara
Fecha: 2008-01-11 09:16:26

cristina escribió:
ooooooooooooooooooooooooo high school musical 2 soy los mejores yo soy una de buestras mejores fans un besiko mui fuertote para todos vosotros. ooooooooooooooooooooo zac eres el mejor vueno todos por igual, adios muamua.a soy cristina
Fecha: 2008-01-11 09:21:45

Fecha: 2008-01-11 10:58:58

ALEXANDRA escribió:
Fecha: 2008-01-11 11:07:15

romero escribió:
hola zac efron es verdad q venis a madrid en firma de cidis
Fecha: 2008-01-11 11:53:56

mraia alejandra escribió:
zac eres un papasito en verdad su musica me encanta y me se los bailes de las dos peliculas y sarphay quiero ser como tu les mando muchos saludos a los demas personajes
Fecha: 2008-01-11 12:08:45

delfina alfie escribió:
chicos me encantan vuestras pelis .sois geniales .
Fecha: 2008-01-11 12:17:15

Raquel escribió:
Me ha encantado HIGH SCHOOL MUSICAL mis personajes preferidos son Vannesa zac efron corbin blue a y Corbin sobretodo me gustas porque has salido en SALTA. Bueno tambien son Ryan y sharpey tengo 9 años osssss kiiiierooooooooo beeeeessoooss a tttoodddooss me encantaria veros.RAQUEL
Fecha: 2008-01-11 12:46:44

(/@gu$\) escribió:
me encantaron sus pelis vanessa es una capa
Fecha: 2008-01-11 16:14:52

adriana escribió:
zac que guapo eres me gustaria darte un beso en la boca
Fecha: 2008-01-11 16:52:53

marta colio escribió:
hola soy la mejor fans
Fecha: 2008-01-11 17:13:51

Enii escribió:
Hola soy Enii..!! Amii me encanta que pusieran la peli de Peter Pan en prsonaa..!! ese chikillo es mas lindoo..(L).!!
Fecha: 2008-01-11 17:43:00

jaqui escribió:
soy la fan #1 de zac
Fecha: 2008-01-11 18:38:41

carlita escribió:
aque zac esta buenisimo alguien sabe si son novios vanesa i zac yo solo e visto la peli por el boy a ser como sarpay
Fecha: 2008-01-12 03:19:21

camila escribió:
hola zak esres un papasote estas mas bueno q bamos te amo de camila bss
Fecha: 2008-01-12 03:38:17

ALICIA escribió:
mencantan los juegos
Fecha: 2008-01-12 03:47:56

GAVIAMNY escribió:
Fecha: 2008-01-24 13:27:16

Ave escribió:
me encanta hsm espero que hsm 3 sea mucho mejor que los otros
Fecha: 2008-01-12 04:27:26

nayara escribió:
buenos diaz soy nayara otra vez les deceo a los de hsm2 mucha suerte para hoy y para otros diaz un besote para todos Nayara
Fecha: 2008-01-12 04:47:34

manuel mateo escribió:
vuestra pelicula la 2 me gusto,pero hicisteis la pelicula demasiado tarde: donde haciais la pelicula teniais calor,pero aqui hacia un frio que te cagabas
Fecha: 2008-01-12 05:05:34

carla platero gonzalez escribió:
mellamo carla y tengo 7 años zac banesa meencanto la peli estoy esperando la tercera ombre si exsiste
Fecha: 2008-01-12 07:05:41

yarelys escribió:
soy la mayor fan de gabriella y hasta tengo muchas cosas de ella me gusta como actua y como baila y como canta
Fecha: 2008-01-12 07:19:56

yarelys escribió:
me encanta como actua gabriella y zac tam bien los dos son los mas fantasticos
Fecha: 2008-01-12 07:21:23

Ana escribió:
Me gusta mucho high school musical 2 pero lo que mas me gusta es Sharpay porque es guapa simpatica bonita de todo , soy su mayor fan
Fecha: 2008-01-12 07:25:24

alguien escribió:
en la peli la mas guapa es sarpey
Fecha: 2008-01-12 09:27:05

josefa escribió:
la mas linda es la gabriela con la sharpeiii y de los hombres el troyyy (L) jajajajaja aviooo :)
Fecha: 2008-01-12 10:33:05

alicia escribió:
yo creo k high school musical 2 esta chula pero como la primera ninguna
Fecha: 2008-01-12 10:38:22

alisson escribió:
hola soi alisson zack res lindo. vanessa ases una bona paraja tu i zack. ashlei ño tebeo en hotel dolce hotel. locas dise queres so mañor fan. mieer comono quierese tu corbin. manique mi opra er mana quieres comotu.
Fecha: 2008-01-12 11:07:44

yari escribio: escribió:
hola¿¡¡¡¡¡¡¡¡son sensacional
Fecha: 2008-01-22 18:16:57

vanessa escribió:
hola vanessa yo tambien me yamo vanessa y yo soy tu fanz#1 #1
Fecha: 2008-01-22 20:45:32

uvi fan number 1 de zac nessa y ash!!**&%# escribió:
las mas wapas de hsm2 son habriella y sharpay y de chicos troy!!!!
Fecha: 2008-01-12 11:43:32

lia escribió:
me gusta tu cote de pelo troy
Fecha: 2008-01-12 13:07:23

franssina escribió:
yo pienso de zack efron es el chico maaaaaaaaaaaaaaas apuesto y bello del mundo
Fecha: 2008-01-12 16:14:42

kiara selene escribió:
yo quiero decirle a zack q es un chico espectacular beo sienpre sus peliculas y es muy bonita bannesa yo quiero q estes con ella y la pianista es una buena chica bueno manda saludos a todos tu amigos besos y soy de peru y mi numero de celula5r es 96716687 llamame si ok
Fecha: 2008-01-12 22:11:22

nayara escribió:
Hola por fin unos diaz mas les deseo a los de High scool musical 2 unos diaz de paz y amor. Les quiero a los de high scool musical 2 con todo mi corazon UN BESO MUY GRANDOTE PARA TODOS .Que se lo pasen muy bien y que no se dejen yevar
Fecha: 2008-01-13 03:10:56

julia escribió:
ME USTA MUCHO HIGH SCHOOL MUSICAL 2 pero high school musical tambn me usta mucho qien no la alla isto q la vea esta muy chula mi personaje faborito es vanessa y troy si veis este msn troy o vanessa llamaz a 954405495
Fecha: 2008-01-13 03:58:07

sara escribió:
me encantan las dos peliculas.zac efron es muy guapo y gabriela soy una gran fan de aslhey y de ryan .osea de todos un beso sara
Fecha: 2008-01-13 05:11:35

june escribió:
esta muy guapo no esta nada mal.
Fecha: 2008-01-13 06:10:16

daniela escribió:
hola como esta yo te quiero mucho a mi me gusta tu programa como actuas como cantas..
Fecha: 2008-01-13 06:13:06

alba escribió:
a mi me gusta troy y ami hermano le gusta Grabiella y sharpay y yo cuando veo a troy me pongo muy nerviosa 16 32
Fecha: 2008-01-13 09:33:04

lucia carrasc escribió:
me encanta vuestra pelicula, por favor si leeis mi msn, os pido os conectais, soy de españa, en andaluca , huelva. aqui teneis muxos admiradores, y admiradoras, como yo, si alguien save los messenger de ellos por favor estoy en
Fecha: 2008-01-23 16:00:12

TERESA escribió:
Fecha: 2008-01-13 10:31:29

****AnA***** escribió:
ME ENCANTAN LAS "2 películas" que habéis hecho hasta ahora ESPERO que hagais UNA TERCERA UNA CUARTA Y MUCHAS MáS.... ANA DESDE Aranjuez (MADRID)
Fecha: 2008-01-13 13:48:38

sara escribió:
sois geeeeeeeeeeniales
Fecha: 2008-01-13 13:54:15

Blanca escribió:
Me encanta la pelide high school musical 1 y 2 mandarme vuestro msñ porfa troy eres mi fan numero 1
Fecha: 2008-01-13 13:55:38

andrea escribió:
bono la pelicula high school musical 1 nu digo k etuviera mu mal peo mola mas la 2 bono abla la pijilla dl insty
Fecha: 2008-01-13 15:33:45

gaby escribió:
zak y ashili son lo ma sigan asi no cambien besos zak casate con vanessa qe tammbien es lo mas .feliz dia de boda
Fecha: 2008-01-13 17:07:14

Fecha: 2008-01-13 19:03:03

ana wapa escribió:
yo creo k esta serie es lo mejor haya en la tele y creo ke deben de haser mas de una
Fecha: 2008-01-14 07:50:51

amanda escribió:
hola me encanta buestra ultima peli por que es la mejor jeje,la cancion de troy y gabriela es emocionante
Fecha: 2008-01-14 07:58:43

ashley melany escribió:
Fecha: 2008-01-14 10:59:32

Fecha: 2008-01-14 11:39:13

manuela escribió:
high scool musical es la mejor peli
Fecha: 2008-01-14 12:42:26

carla escribió:
me encanta las dos peliculas se salen
Fecha: 2008-01-14 14:16:28

vanessa escribió:
high school musical es la mejor pelicula de disney channel y espero que algun dia se presenten en peru. chau a todos los de high school musical cuidense de su amiga vanessa y yesi.
Fecha: 2008-01-24 13:41:52

viky escribió:
hola a todos jeje ami me encanta disney chanel estoy todo el dia viendolo no paro de meterme en paginas de disney chanel, bueno ami me gusta hanna montana y tambien high school musical y tambien raiven ect.. me gustaria tener sus msn el mio es
Fecha: 2008-01-14 15:45:40

carlos escribió:
hola a todo son lo maximo me llamo carlos de caracas venezuela me gusteria que gabriela me diera se msn y cobi bleu.. los admiro mucho y cobi tambien me gusta tu pelicula jupi...
Fecha: 2008-01-14 19:13:22

***^ Jesus ^*** escribió:
Hola a todos les deseo suertes a todos ..... Me gusto como travajo gabriella enhigh school musical 1 y 2 ... corbin bleu sige asi me gusto tu personaje en high school musical 1 y 2 y junp in ..... Les deseo suerte a todos bye los admiro muchisimo.......
Fecha: 2008-01-14 19:29:22

ANTONIA escribió:
hola soy Antonia y me gusta mucho high school musical 2 y sobre todo como cantan les felicito.Cuando sean mas grandes seran los mejore cantantes del mundo entero besitos para todos.
Fecha: 2008-01-15 08:38:49

melany, laura y lara escribió:
Hola chicos de high school musical !!!!!!!!!!!! le queriamos decir que ustedes son terriblemente aburridos y no saben lo que es actuar, por suerte ustedes nos tienen a nosotras porque somos the best , mandame un video así lo renobamos y ven que tan buena somos nosotras . Me quiero mucho melany, lauri, y lara
Fecha: 2008-01-21 21:04:06

Fecha: 2008-01-15 10:41:56

melany, laura y lara escribió:
Hola chicos de high school musical !!!!!!!!!!!! le queriamos decir que ustedes son terriblemente aburridos y no saben lo que es actuar, por suerte ustedes nos tienen a nosotras porque somos the best , mandame un video así lo renobamos y ven que tan buena somos nosotras . Me quiero mucho melany, lauri, y lara
Fecha: 2008-01-21 21:04:40

antonella escribió:
soy antonella y los kiero mucho ps
Fecha: 2008-01-15 10:56:34

ariadna escribió:
me encanta como sale troy bolton en la 2 es superwapo me gustaria acer una palicula las canciones son fabulosas me encata sobretodo la de EVRIDAY
Fecha: 2008-01-15 11:42:19

melany, laura y lara escribió:
Hola chicos de high school musical !!!!!!!!!!!! le queriamos decir que ustedes son terriblemente aburridos y no saben lo que es actuar, por suerte ustedes nos tienen a nosotras porque somos the best , mandame un video así lo renobamos y ven que tan buena somos nosotras . Me quiero mucho melany, lauri, y lara
Fecha: 2008-01-21 21:04:45

melany, laura y lara escribió:
Hola chicos de high school musical !!!!!!!!!!!! le queriamos decir que ustedes son terriblemente aburridos y no saben lo que es actuar, por suerte ustedes nos tienen a nosotras porque somos the best , mandame un video así lo renobamos y ven que tan buena somos nosotras . Me quiero mucho melany, lauri, y lara
Fecha: 2008-01-21 21:04:47

kevin escribió:
hola chicos de high school musical oye troy soy tu fan numerouno
Fecha: 2008-01-15 20:39:45

mona escribió:
zac tu me encantas la cancion tuya que mas me gusta es apuesta por ello me gustas mucho en todos los acpectos y eres un grandisimo actor vete a por sharpey o a por mi que tambien tengo 19 años un besazo guapo
Fecha: 2008-01-23 14:32:06

CAMILA escribió:
Fecha: 2008-01-16 08:56:07

CAMILA escribió:
Fecha: 2008-01-16 09:00:42

melany, laura y lara escribió:
Hola chicos de high school musical !!!!!!!!!!!! le queriamos decir que ustedes son terriblemente aburridos y no saben lo que es actuar, por suerte ustedes nos tienen a nosotras porque somos the best , mandame un video así lo renobamos y ven que tan buena somos nosotras . Me quiero mucho melany, lauri, y lara
Fecha: 2008-01-21 21:04:48

kamila escribió:
hola me encanta zac odio a vanessa es una tonta bno mi msn es para los que quieran hablar con migo bye cuidesen
Fecha: 2008-01-21 22:31:58

kamila escribió:
hola me encanta zac odio a vanessa es una tonta bno mi msn es para los que quieran hablar con migo bye cuidesen
Fecha: 2008-01-21 22:32:29

claudia escribió:
me encanta
Fecha: 2008-01-16 10:31:09

micaela escribió:
holaaa ... me encanta troy es re lindo aparte es un bonbon
Fecha: 2008-01-16 10:46:51

dayan escribió:
agregemen a su lista de contacto estare conectado chao ny gracias linda
Fecha: 2008-02-13 12:48:49

antonella escribió:
hola hsm 2 vanessa sos la mejor zac sos relindo keni ortega sos un genio byeeee
Fecha: 2008-01-16 12:38:06

BLANK escribió:
Fecha: 2008-01-16 13:27:48

maria escribió:
hola......... me encanta high school musical me encanta ashley tisdale,vanessa hudgens, lucas grabeel y me encanta zac efron soy la fans numero 1 ojala que saquen hsm 3, tengo un posters de high school musical... ah y me gusta RBD besos cuidense muuuuuuuuuuuuuuuuuuua...... el que quiera chat con migo hay esta mi msj......
Fecha: 2008-01-22 07:19:33

SARAHY escribió:
me gusto mas por la partisipacion de zac efron
Fecha: 2008-01-16 18:33:10

florencia escribió:
yo soy florencia y quiero que me agregen
Fecha: 2008-01-17 08:36:49

FLORENCIA escribió:
Fecha: 2008-01-17 11:43:26

sandra escribió:
Fecha: 2008-01-17 13:04:57

estherin escribió:
ola me encanta high schol musical i mas series de disney channel vanessa hudgens i zac efron son mis preferidos me encantaria conoceros bss a tosos
Fecha: 2008-01-17 13:11:14

santiago escribió:
hola soy santi y me encanta los dos high school musical y tan bien muchos mas de disney como zack y cody cory, cory en la casa blanca, la pelicula betoben, zz, y carla la del zz es una mamasota chao me encanta disney
Fecha: 2008-01-17 13:44:05

claudia mesa redodo escribió:
sois lo mejor the girl ohhhh fabolous asley tisdale
Fecha: 2008-02-12 06:43:23

troy escribió:
hola chicas soy yo troy .renata voy a ir a tu fiesta.jennifer voy a ser tu novio .chao
Fecha: 2008-02-15 08:19:02

zurelys escribió:
hello mi gran sueño seria conocer a los high school musical pero se ke eso nunca va a poder ser. desde la calle guanajuato nº13, salto del negro, las palmas de gran canaria.
Fecha: 2008-01-17 14:00:25

maria escribió:
hola......... me encanta high school musical me encanta ashley tisdale,vanessa hudgens, lucas grabeel y me encanta zac efron soy la fans numero 1 ojala que saquen hsm 3, tengo un posters de high school musical... ah y me gusta RBD besos cuidense muuuuuuuuuuuuuuuuuuua...... el que quiera chat con migo hay esta mi msj......
Fecha: 2008-01-22 07:20:51

mariela escribió:
zac te kiero estas buenisimo tengo un novio k es igual de cara que tu y de cuerpo tambien . si me kieres ver vivo en tenerife soy modelo tengo 20 años y naci en california pero hablo español.un beso muy grande
Fecha: 2008-01-17 14:49:46

gisel escribió:
hola quiero decir que zac efron es hermoso y ashley tisdale tambien es linda ojala que zac este con ashley aca les dejo mi emeil para que me agreguen y podamos charlar seria un placer charlar con ashley y zac el amor de mi vida.
Fecha: 2008-02-12 09:28:14

mili a. escribió:
me encanta sus dos peliculas espero que hagan muchas mas. los re quiero
Fecha: 2008-01-17 15:27:11

isabel escribió:
Fecha: 2008-01-17 16:02:56

jade escribió:
me encanta high school musical 2 el troy y la gabriela son mis fans numero 1
Fecha: 2008-01-17 17:36:26

mary escribió:
paula yo soy la amiradora numero 1 por cianso mona
Fecha: 2008-01-17 19:50:15

KTthiita escribió:
hola me encanta high school musical es lo maximo¡¡¡¡¡¡¡
Fecha: 2008-01-24 15:14:15

Gabriela escribió:
Me encanto mucho hig school musical 2 espero que hagan la 3 un beso bai
Fecha: 2008-01-24 17:09:22

cecilia escribió:
me encanta high school musical. me muero por ver la tercera pelicula.zac esta bueniiiiiiiiiiisimo
Fecha: 2008-01-25 10:15:08

agustina escribió:
hola como estan quiero conoser a vanesa
Fecha: 2008-01-25 10:18:10

cristian escribió:
high shool musical 1y 2 son genial pero yo kiero k salga high shool musical 3y 4 y 5
Fecha: 2008-01-25 15:39:37

vinyet ris escribió:
Fecha: 2008-01-26 06:41:47

paula escribió:
Hola troy grabiela chat taylor sharpay rayan me ha gustado mucho la pelicula os felicito !!!!!!!! bueno ya nos veremos
Fecha: 2008-01-26 07:02:50

raquel escribió:
ola ke tal estais?a mi high school musical me encanta muxo y es mi serie favorita es el meor y troy me gusta mazo bueno xau
Fecha: 2008-01-26 07:29:53

Marta escribió:
ola soy Marta os quiero
Fecha: 2008-01-26 08:45:29

fiorela escribió:
la musica es chefre quisiera tener el celular de high school musica 2
Fecha: 2008-02-08 11:58:02

Jaya escribió:
Ami me encanta High School Musical por que aunque la primmera vez que la vi no me gusto por que vi media luego la volvi a ver y me gusto tanto que la tuve que volver a verla
Fecha: 2008-01-21 14:13:56

sofia belen guardia escribió:
holis!!! les quiero decir q esta buenisima las pelis que hicieron son muy buenos actores chau!!!!!
Fecha: 2008-02-12 09:39:18

cami escribió:
soy fans de troy y gabriela hacen una pareja perfecta me encanta es lo + besosssssssssssss chauuuuuuuuuu
Fecha: 2008-02-15 09:38:14

maria escribió:
me encanta hsm, poreso ospido iconos y fondos de hsm
Fecha: 2008-01-18 11:16:46

vanezza escribió:
Fecha: 2008-01-18 12:08:29

maria escribió:
Fecha: 2008-01-22 07:24:33

isis escribió:
hola hsm es lo mejor todos son unos paoitos pero el que esta mas bueno es zaz efron te amo zaz bay
Fecha: 2008-01-18 16:02:33

MONIKA & HELENA escribió:
Fecha: 2008-01-18 16:30:58

aLeexiis alexis_gilberto escribió:
pos hsn es la peli mas chida de toda america esta supeer padreee es lo mejor soi fans dde ellos numero #11 los admiroo muchoo se ke es un grupo muui famoso sii eres super hsmm bababes pos me les boii .....nnoo los kiero dejar pero bueno byeeee estan super el personaje k mas me gusta es el de sharr.. por k coincide conmigo por lo fressaa bye
Fecha: 2008-01-18 16:33:00

gerbacio escribió:
hola yo ya vi hsm2 como 800 veces soy fan de ashley tislade
Fecha: 2008-02-06 11:13:04

camila escribió:
me gusta troy es tan lindo y hermoso lo amo
Fecha: 2008-01-18 16:54:41

olga cristina crespo garcia escribió:
.me gusto mucho cuando troy no le cumplia nada a gabriella y le dijo si siges asi entonces ya no quiero seguir con tigo y le devolvio el collar y se fue.
Fecha: 2008-01-18 17:29:10

valentina escribió:
quisiera desir que zac es hermoso y vanessa es la mas lida de high school musical 1 y 2
Fecha: 2008-01-18 17:48:45

yrene escribió:
soys los mejores... Zac estas weníííísimo...sigue así.Y ponte gafas porque de tanto forzar la vista te estas quedando vizco...con gafas o sin gafas sigues siendo igual de wapo.
Fecha: 2008-02-06 11:21:21

Irene escribió:
Siempre que voy a un cumpleaños regalo uno de vuestros discos.
Fecha: 2008-01-19 03:44:31

nayara escribió:
hola mi msn es Y quiero que vannesa,efron,zac y daniela ablen con migo les quiero a todos con locura y con todomi corazon les adoro vannesa eres un mogoñon de buena y de guapa,effron estas cantando de forma increible te felicito,zac estas un mogoños de wapo eres el mejor y daniela tu tambien eres la mejor igual que vannesa.zac y efron son los mejores cantantes de high scool musical 2 UN BESO MUY GRANDE PARA TODOS LOS DE HIGH SCOOL MUSICAL2
Fecha: 2008-01-19 04:30:44

rocio escribió:
Hola a todos de high school music un beso para todos agregarme en el msn xao
Fecha: 2008-01-19 06:33:27

amaia escribió:
a mi me gusta hannah montana es la mejor i la + wpa de todas,weno tambien es corbin blue!!!!!!!!wenu chao, un muak fuete pa todas!!!
Fecha: 2008-01-26 09:29:43

rocio suyay escribió:
un beso a todos soy fanatica de ustedes ro
Fecha: 2008-01-19 08:43:25

valery de los angeles escribió:
gracias por agregarme a su lista un beso a todosa los personages
Fecha: 2008-01-19 10:17:57

noemi escribió:
hola soi noemi me encantaria veros yo beo todas las series de disnney channel yo y mi prima y mi amiga esther tenemos el album y la revistas i las cartas yo quiero que por mi mesenyer me mandeis fotos tuyas
Fecha: 2008-01-19 10:30:43

noemí sánchez lázaro escribió:
hoa!! los personajes son muy hulos a mi me encantan sobre todo aslhey tisdale es la + wapa y la mejor y eltio mas bueno es zack efron vueno besos y recuerdos a todos xao
Fecha: 2008-01-23 04:12:06

andrea escribió:
hola , esos juegos son muy guays y no se si participar en high school musical locos por el baile con mi clase osea cuarto b , je,je,je
Fecha: 2008-01-19 13:26:11

Daniel Armando escribió:
ke onda pues muy padre hsm y hsm2 amo a Vanessa Hudgens
Fecha: 2008-02-06 16:23:28

claudia escribió:
esos juegos me gustaron y pase a artos niveles guao
Fecha: 2008-01-19 19:37:06

grecia monserrat escribió:
hola soy grecia los amo me se todas las canciones y la verdad no me gusto el comentario de ana MARIA Y ESTOY DEACUERDO CON EL DE ANA KAREN
Fecha: 2008-01-19 21:07:30

JOSELIN escribió:
Fecha: 2008-01-19 21:53:35

cris_peke escribió:
Holaa soy su primer fan me encanta todas vuestras canciones me las se todas bueno me gustari estar en vuestra lista y conozeros en persona
Fecha: 2008-01-20 04:14:41

Beatriz escribió:
Hola soy la fan numero 1, me encantan las 2 pelis de high school musical y seguro que a más niños tambien, y por eso no podeis dejar de hacer más pelis queremos que tambien alla una 4ª película.
Fecha: 2008-01-20 05:08:02

almudena cuevas escribió:
hola soy la niña que mas cosas tiene de high school musical tengo a las muñecas gabriela y sarpey y a troy tengo la carpete y la agenda lo tengo todo hos quiere mucho almudena de cordoa
Fecha: 2008-01-20 08:21:19

judith escribió:
ola necesito iconos de high school musical porfabor kien etnga ke me agrege muxas gracias a todos y a zac te amo dew soy
Fecha: 2008-01-24 07:37:11

luz maria escribió:
ola vanesa come estas
Fecha: 2008-01-20 22:55:48

EUGENIA escribió:
Fecha: 2008-01-21 06:37:50

denisse escribió:
hola vane soy tu fan no 1 son unos genios los que protagonisaron e hicieron la peli bueno 0.y zac efron harian una buena pareja bueno gracias
Fecha: 2008-02-12 20:53:23

luisa fernanda escribió:
es guay es la mejor y algo q queria buscar novio lo necesito de 11 a 12 mi msn es muaaaaaaaaaaaa adios
Fecha: 2008-01-23 07:42:54

xdxdxd escribió:
es tan lindo troy deverdad es hermoso
Fecha: 2008-01-26 12:59:36

veronica escribió:
ola high school musical kiero ke zepan ke loz amo en ezpezial a ti troy erez mui guapo amigoz kiero ke vengan aculiacan y porfavor agan la peli de high school musical 3 ezke me guzto muchizimi la 2 y ovio la 1 bueno chau bezoz bezotez en ezpezial a ti troi
Fecha: 2008-02-08 12:59:47

karen escribió:
es tan linda vannesa y tambien los otros
Fecha: 2008-01-26 14:18:56

soy la mas divina de odas jajaj mentiras todas somos divinas bueno mas yo bueno me gusta muchozac efron pienso k es un bombom y no pienso lo es jajaj chauuu:)
Fecha: 2008-01-26 15:30:18

alba maria escribió:
¡¡¡¡ i love hsm espero k lo leais besos''''
Fecha: 2008-02-13 11:04:06

lucia escribió:
os quiero soy lucia me a encantado todas las pelis de high scool musicalsoy buestra fan numero 1 a y creo que gabriela y troy acen muy buena pareja. besos xau
Fecha: 2008-01-26 16:21:17

elsa escribió:
lucas eres el mejor y troy ojala ke algun dia puedan leeer esto sus canciones son lo maximo
Fecha: 2008-02-08 15:16:36

iara y dan escribió:
holis:nosotros pensamos que hsm 1 y 2 estan completamente copadas y no pensamos ni aguantamos en ver hsm 3 !!!! somos su fan numero 1 !!! besos bye!
Fecha: 2008-01-26 18:23:16

Maruca escribió:
holas! tengo 8 años! no voy a opinar sobre la web!! pero seguro q esta buenisima la web! me voy y le voy a decir a vanessa q es una feaaa!! kiss!!! bye
Fecha: 2008-01-26 19:31:57

marina escribió:
Hola tengo 14 años y amo a zac efron
Fecha: 2008-01-27 05:03:49

joan escribió:
ola zac soy tu mejor fam
Fecha: 2008-01-27 06:51:15

maria eduarda escribió:
me hencanta high school musical ,pero tambien hotel dulce hotel los actores de esos programas es:ASHLEY,ZAC,VANESSA,MONIC,CORBIN,COLE,DYLAN,BRENDA,PHIL,Y KIM os quiero mucho a todos BSSSSSSSSSSSSSSSSS
Fecha: 2008-01-27 09:04:43

Alejandra Soto Siva escribió:
corbin blue esta bien guapo y q zac no sea novio de vanessa y me encanta la pelicula ojala ya salga la 3
Fecha: 2008-02-08 15:27:08

helena escribió:
me encanta high school musical me gustan como bailan jeje tq
Fecha: 2008-01-27 09:34:28

Mario escribió:
Gabriela ¿te casas conmigo cuando sea mayor?
Fecha: 2008-01-27 13:05:18

lucia escribió:
soy la mejor pero..... mis amigas tambien
Fecha: 2008-01-27 14:33:00

carla escribió:
saludos para los chicos de hig school music sus canciones son buenas y sus peliculas.
Fecha: 2008-01-27 20:30:05

Berta escribió:
Ami me gusta mucho en Troy i la Gabriela
Fecha: 2008-01-28 12:47:43

Antonella escribió:
Me gustaria q Zac Efron en ves d ser novio d vanessa tendria q ser novio d ashley , es EDUCADA y sabe lo q hace.
Fecha: 2008-02-08 02:38:21

agus escribió:
hola estoy muy contenta de haber visto la peli me gusto mucho.Chauuuu!!!!!!!!!
Fecha: 2008-02-08 09:57:53

chiara escribió:
gabriella y troy en muñecos y en persona son hermosos los amo. chausito.chiara
Fecha: 2008-01-28 17:23:22

yrene escribió: escribió:
soys los mejores... Zac estas weníííísimo...sigue así.Y ponte gafas porque de tanto forzar la vista te estas quedando vizco...con gafas o sin gafas sigues siendo igual de wapo.
Fecha: 2008-02-06 11:23:03

isidora antonia luz escribió:
me encantan sus canciones
Fecha: 2008-01-29 09:19:07

luz y lautaro escribió:
son todos increibles los adoramos ! bye sigan asi ah y si alguien tiene la casilla de correo de msn porfis denmela besos bye!
Fecha: 2008-01-29 09:46:01

julissa escribió:
Ola yo soy fanaticos de ustedes son muy dibertidos quisiera conoselos px un beso pa todos los kelo............byeeeeeeeee
Fecha: 2008-01-29 10:54:22

laura escribió:
te amoooooooooooooooo troy
Fecha: 2008-01-29 17:40:08

alba escribió:
waaaww jajajaja sois la bomba la pelicula es muy chula prfavor enviarme un posterde zac (troy) porfavor pero la pelicula esta muy chula!!!
Fecha: 2008-02-09 12:31:05

sofia escribió:
me encanta high school musical 2 porque son mas lindas las cansiones y ya me se todos los pasos yo pense que eran re difisil y despues te que bi como 4 o 5 beses la peli ya me salia los pasos y mi primo no me creia yo soy re famosa de high school musical 2 de todos los chivos de la peli no de troy y gabriela soy de todos si quiero conoser a troy y gabriela conosco a todos si espor mi pero lastima que ablan en otro idioma pero me da lo mismo ogala que siempre sea famosa de high school musical pero alguna ves ya me tendre que olbidar pero eso no ba a pasar nunca chau
Fecha: 2008-02-09 13:08:27

lupita : escribió:
hola a todos yo soy super fan de hsm y mas de zachari efron me encanta hsm desde la 1ªla vi el dia de estreno tambien la 2
Fecha: 2008-02-15 13:03:34

oriette escribió:
hola me llamo oriette tngo 10 añitos q trist jeje..les kiero dcir q el juego es una porqueria jeje.. no mentira es mas buenoxxx me enknta jeje..los amo jonas brothers y mas a nick ,nick estas d un buenoxxxx jej..ashlye soy tu fans nº # 1 jeje ..mas buenoxxx..bye besos y le kiero mandar saludos a mi mejor a miga joemar valeria aldazoro ojeda valeria eres mi mejor amiga t.q.m valeria cuidat
Fecha: 2008-02-06 13:18:20

leslie escribió:
hola aver al principio me encantabais pero les mande un monton de mensajes al pagina y jamas me contestaron se q esto se supone q es para darles muchos cumplidos pero yo solo doy mi opinion en publico aver si empezais a ser mas buenos con las personas q os adoran pd:sharley me encantas y en zak y cody sos la mejor
Fecha: 2008-01-30 13:24:12

mayra alegre escribió:
hola TROY ES UN BOMBOM mire unas fotos donde se fue a Hawai con Gabi Y se ve que la pasaron bomba besos MAY.
Fecha: 2008-01-30 14:29:32

gabriela NATALIA escribió:
OLI ME LLAMO GABRIELA TENGO 10 AÑOS Y ME GUSTA ZAC YO SOY DE CHILE Y DELA CIUDAD DE ANTOFAGASTA Y ME GUSTAS EL PERSONAJE QUE ASE ZAC y me gustaria que me des tu fotolog y tu msn yo estoy de cumpleaños el 27 defebrero te krm te amo y espero que nos casemos te quero ati tambien codi mandenme regalos poooooo.....
Fecha: 2008-02-07 10:37:29

maria escribió:
sois los mejores troy guapo gabriella tienes suerte de aver conocido a troy guapooooooooooooooooooooooooooooo
Fecha: 2008-01-31 12:58:18

Eva escribió:
Soys los mejores venir a españa WAPOS!!!tengo un monton de cosas vuestras!!!!!OS QUIERO UN MONTONAZO!!!
Fecha: 2008-01-31 14:31:19

juan camilo perilla escribió:
me encanta high school musical tengo los cd,el juego de mesa, la peli,el juego de nintendo dies y mucho mas
Fecha: 2008-01-31 14:43:23

paula escribió:
de high school musical me gusta mas la pelicula 1, per las canciones de la 2
Fecha: 2008-01-31 15:21:56

FABIANA escribió:
Fecha: 2008-02-07 11:42:33

yazmin escribió:
hola soy yamin soy la admiradora del zac efron es un papasito y ami no me gusta la vanessa easta muy fea y la sharpey esta muy bonita bueno eso fue mi comentario
Fecha: 2008-01-31 19:59:59

yazmin escribió:
hola soy yamin soy la admiradora del zac efron es un papasito y ami no me gusta la vanessa easta muy fea y la sharpey esta muy bonita bueno eso fue mi comentario
Fecha: 2008-01-31 20:01:07

melisa vinaroz escribió:
zac , vanesa , ashley os admiro muchisimo y sois super guapos sobretodo zac le besaria quiero ver la peli 3 y os ire a ver a Londresguaposssssssssss!!!!!!!!!
Fecha: 2008-02-01 05:00:27

amaia txiki escribió:
me gusta mucho
Fecha: 2008-02-01 12:33:04

laura escribió:
ola soy laura pero me llaman laurita, tengo 10 años y quisiera deciros que la peli 1 como la 2 me encanta pero si sacais la tercera porfa que sarpei sea amiga de gabriela y que no intente quitarle el novio a gabriela bueno que sepas zac efron eres el chico mas guapo de la tierra espero que algundia te vea en persona bsss tkm chauu chaoo
Fecha: 2008-02-13 10:44:15

Mar escribió:
me gustaaaaaaaaaaaaaaaaaaaaaaaaaaa ZACHARY ES LO MAS GUAPO QUE AY EN EL MUNDO
Fecha: 2008-02-07 14:15:45

karla escribió:
hola a todos los de high school musical 2 les quiero decir si me pueden dar su messinger como se lo dieron a una compañera ella me dijo que se los pidiera y yo soy la mas fanatica de ustedes tengo todo lo que ha salido a la venta de ustedes y tengo las dos peliculas y el albun pero lo que no tengo es el messenger de ustedes me lo pueden dar plis xau
Fecha: 2008-02-01 17:57:57

meli escribió:
hola chicos le keria decir ke me encanta zac efon i kisiera ke fuera mi novio ustedes no berdad ke esta super gupo
Fecha: 2008-02-09 11:49:54

valeria escribió:
hello a todoos los de high school musical 2 soy fan de ashley se todo sobre ella y tambien de vanessa, si me pueden dar su mesingerr gracias bye
Fecha: 2008-02-01 18:58:36

maria escribió:
hola high school musical...estoy impaciente por ver high school una fan de todos vosotros.a mi me gustaria que me dierais el msn de zac,ashley y vannesa...bueno os vere en high school musical3 good bye...
Fecha: 2008-02-02 05:34:22

alba maria escribió:
me encanta zac efron zac si kieres salir con migo llamame kisiera conocer a zac y a zannesa para darle un beso a cada uno de su admiradora para zac i love en ingles ti amo en italiano y lo mucho k lo kiero lo digo en castellano besos mi amor
Fecha: 2008-02-13 11:00:52

alba escribió:
yo estoy apasionada con high school musical 1 y 2 y supongo k la 3 tambien me gustara jijijijijijijijijijijijijijijijijijijij
Fecha: 2008-02-02 11:39:41

paula escribió:
yo estoy encantada de high school musical 1y2 porque estan chulas y supongo que todas las que saquen estaran chulas un beso
Fecha: 2008-02-02 13:11:10

laudis escribió:
me encanta high chool musical. si binieran aqui a repubica dominicana no me pelderia su consielto y espero q bengan
Fecha: 2008-02-02 22:37:10

Inmaculada Castaños Carreras escribió:
Quiero jugar con high school musical 2
Fecha: 2008-02-03 07:34:00

zaloausky escribió:
hih scool musical es lo mejor porke para empezr troy esta como un bombon y vannesa tiene suerte porque estan liados yo en clase estoy pensando en el y no me entero solo de ke se ke esta como un bomboncito
Fecha: 2008-02-03 08:34:01

Nathaly Araujo escribió:
high school musical es lo mejor de lo mejor ,soy admiradora 100%.zac esta bueniiiiiiiisimo.
Fecha: 2008-02-03 10:37:26

Melx!!! escribió:
hola soy Mel y les queria decir que yo soy la admiradora Nº 1 DE Sharpay Evans (Ashley Tisdale). Lo tengo todo de ella y me encanta sus canciones. Tambièn me gusta mucho Gabriella Montez (Vannesa Hudgens) y tambien lo tengo todo bueno no es exageracion porque es verdad y tambien tengo todos los posters de Troy Bolton (Zac Efron), Gabriella Montez (Vannesa Hudgens), Shrapay Evans (Ashley Tisdale), Ryan Evans (Lucas Grabeel), Chad Danfort (Corbin Bleu) y Taylor Mcquessi (Monique Coleman) y todas las revistas de todos los numeros, no me falta ninguna ahn y por sierto este es mi correo: y espero que me agreguen Chausito............
Fecha: 2008-02-03 14:38:18

Alejandra Soto Silva escribió:
Fecha: 2008-02-08 15:55:21

brayan escribió:
hola soy nestor
Fecha: 2008-02-03 19:13:37

cristina escribió:
Hola soy Cristina y me gustan un monton de personajes como:Vanesa,troy,chad,ashley ect...... A unas amigas, que se llaman Elena.s.s y Maria.g les encanta troy borton, y casi siempre estan hablando de el dicen,¡que esta de muerte a y un beso muy fuerte a todos.
Fecha: 2008-02-04 04:46:29

sheyla escribió:
disney channel es super guay yo lo estoy viendo siempre. yo en high school musical yo soy ¡¡¡¡¡ sharpein ¡¡¡¡¡¡ en mi coleguio todos me llaman sharpein
Fecha: 2008-02-04 06:26:40

ANDREA escribió:
Fecha: 2008-02-04 07:40:07

irene escribió:
ola ami me gustaria que en high school musical 3 la sharpay(ashley)y troy(zac)se besaran. hacen la parejita ideal a i una cosa vanessa hugdens se hizo fotos desnuda i estan colgadas en el google en imagenes es una traidora
Fecha: 2008-02-13 12:12:33

renata escribió:
Hola high school musical yo tengo 7 años.Espero que vengan ami fienta de 8 años es el 16 de noviembte.chau
Fecha: 2008-02-14 21:13:01

dayan escribió:
agregemen a su lista de contacto estare conectado chao ny gracias linda
Fecha: 2008-02-13 12:47:04

mariana escribió:
hola a todos pero en espesial a zac k esta bien guapo y k lo amo,adoro y k me encanta esta super super GUAPO
Fecha: 2008-02-04 20:32:05

Marta Galiano Garcia escribió:
Fecha: 2008-02-05 03:44:23

maria de los angeles escribió:
hola a mi me gustariaa q zac sea novio de ashley a annesa la odio es una t... ashley es mi idola
Fecha: 2008-02-08 19:09:40

ariadna escribió:
Fecha: 2008-02-05 10:53:14

ygnerik torrealba escribió:
hola como estan espero q bien por q me encanta su pelicula y desearia conoserlos y a ustedes les deseo mucha suerte los quiere ygnerik carolina torrealba rodrigues lo quieros mucho
Fecha: 2008-02-05 11:40:12

aytami escribió:
me encanta hsm zack corbin vane ashley ryan teilor...estoy desesperado por ver la tercera demen sus correos mas que sea el de zack tengo 9 años chao beses
Fecha: 2008-02-09 05:32:47

aytami escribió:
me encanta hsm zack corbin vane ashley ryan teilor...estoy desesperado por ver la tercera demen sus correos mas que sea el de zack tengo 9 años chao besos
Fecha: 2008-02-09 05:33:08

alejandra nicole escribió:
me caen super son los mejores sigan adelante se que lo pueden hacer mejor bamos ariba ........
Fecha: 2008-02-05 12:20:37

karla muñoz escribió:
hola me gusta hsm por los personajes
Fecha: 2008-02-05 12:53:02

CARME escribió:
sabiais k la vannessa anne hudgens se droga
Fecha: 2008-02-09 06:48:39

camila escribió:
yo no estoy de acuerdo con que zac tenga novia asi rompe el corazon de muchas niñas incluyendome a mi.
Fecha: 2008-02-05 18:29:35

karla isabel escribió:
yo no estoy de acuerdo con que zac sea novio de vanessa me gustaba mas cuando era novio de ashley
Fecha: 2008-02-05 23:07:43

Fecha: 2008-02-09 13:47:15

Susana escribió:
ME ENCANTA HSM LA 1 Y LA 2!!!!!!!!!!!!!!!!!!
Fecha: 2008-02-09 14:09:40

Magdalena Moragues Porquer escribió:
Fecha: 2008-02-09 15:47:37

tairobi escribió:
Fecha: 2008-02-14 11:35:21

Magdalena escribió:
Fecha: 2008-02-09 15:50:55

yahayra escribió:
hola como estas estube muy mal no se q me paso teb extraño chauuuuuuuuuuuuuuuuuu tu amiga yahayra
Fecha: 2008-02-09 16:31:18

carolina escribió:
high school musical es lo mejor pero la parte mejor es cuando canta troy y gabriela
Fecha: 2008-02-22 16:04:56

Alexa_la_mas_linda escribió:
Hola soy alexa de 4a ya se q hay un monton de alexas pero yo soy de argentina rosario no secmo se mjuega ni hay para jugar eso creeo bueno les mando aludos a mis amigo y amigas de mi colegio ....¡¡¡ - Les quiere mucho- ----------------- Alexa gonzalez chaoooo¡¡¡¡¡
Fecha: 2008-02-09 17:08:17

angela escribió:
estas como un tren zac y vanessa segun uno de mi clase y segun yo eres genial escrividme mucho si me mandas algo zac me desmallo chaito
Fecha: 2008-02-10 09:27:55

nahomi escribió:
hola le quiero mandar muchos saludos a zac ,me encanta su personaje y le quiero decir que que haga un cd canta muy bien y soy su mayor fan y lo amo besos a y que siga asi de bueno
Fecha: 2008-02-10 11:08:06

XITLALI escribió:
Fecha: 2008-02-14 16:49:34

génesis escribió:
hola les quiero mandar muchisimos saludos a todos los de high school musical y q amo a zac y los quiero muchisimo a todos y q soy su fans numero 1°
Fecha: 2008-02-10 19:50:36

sofia escribió:
hola a todos tengo 9 años bueno me gusto mucho las dos peliculas =)besos los quiero mucho
Fecha: 2008-02-10 20:17:05

diana escribió:
porfavor tengo cancer agregenme me gustaria hablar con untedes cuidense bye
Fecha: 2008-02-10 21:34:15

*/*/luli*/*/ escribió:
hoolaa me encanta hsm 2 esta copadaaa!!!!! bye bye !!!! besoooosss /*/*luli*/*/
Fecha: 2008-02-11 07:38:34

*/*/fernanda efron*/*/ escribió:
hi i'm fernanda i'm 12 years old i love my brother zac efron bye mahria fernanda efron usa
Fecha: 2008-02-11 11:46:41

ROCÍO escribió:
HOLA SOY ROCÍO DE ARGENTINA Y QUERIA DECIRLES QUE ESTA BUENISIMA LA PELI .Zac sos beatifol, venesa sos re dulce ashley y lucas son unos capos como actuan bueno chauuuuuuuuuuuuuuuu
Fecha: 2008-02-11 16:01:23

jennifer escribió:
hola soy jennifer les queria decir que soy fan de asthile tisdale me encantaria que este con zac efron tambien les mndo besos a zac los quiero chau
Fecha: 2008-02-11 23:35:46

alexis escribió:
hola a todos soy fan numero 1 de ustedes y kiero k vengan a mi fiesta de 9 años chau los kiero cuidense chau bye
Fecha: 2008-02-15 20:56:29

ALAN escribió:
Fecha: 2008-02-15 22:14:38

valeria whittembury neyra escribió:
zack efron y vanessa hudnguns suerte el la protsima filmacion
Fecha: 2008-02-16 08:50:23

paloma escribió:
high school musical 2 es lo mejor xk tiene muchas canciones y muchos bailes
Fecha: 2008-02-16 12:56:39

andrea nuñez rodriguez escribió:
hola vanessa eres la mejor i cuando besas a zac hoooo¡¡¡¡besos xxxxxx
Fecha: 2008-02-16 14:11:44

ariadnny escribió:
odio a high school musical soy ariadnny andrea portillo gonsales y soy novia de carlos casrillo tengo 13 años
Fecha: 2008-02-27 10:11:09

belen escribió:
high school musical es mi grupo favorito y mis personajes preferidos son Zac y Vanesa. Me gustaria verlos en persona.
Fecha: 2008-02-16 14:21:59

josefa escribió:
me se todas las cansiones de high scool musical 2 y amo a zac y vanesa es muy linda desearia que fueran a mi cunpleaños y que cantaran con migo vivo en holanda con simon bolibar 3235. que lo pasen bien xau besos zac y vanesa.
Fecha: 2008-02-16 19:45:10

Michelle Daniella Camargo Santillan. escribió:
Me gusta mucho High School Musical mucho me gusta cuando cantan tengo todos los cidis y videos de la peli,me gusta como canda ashly tisdale con Zac Efron de Yuar de music en my dengo las revistas parese que colecciono quisiera que Zac con Vanesa estubieran cantando en mi cumple me gusta Zac Efron como es.
Fecha: 2008-02-16 21:52:47

beatriz escribió:
me encanto la 1 de hihg school musical
Fecha: 2008-02-17 08:50:38

beatriz escribió:
hola soy beatriz tanbiem me gusta hotel dulce hotel
Fecha: 2008-02-17 08:58:57

michelle escribió:
hello chicos como estan me gustaron los programas detras de camara deustedes chao
Fecha: 2008-02-17 16:53:04

maria camila muñoz pajaro escribió:
Fecha: 2008-02-22 16:22:04

CLARA escribió:
Fecha: 2008-02-18 10:32:12

esteisi estefani escribió:
troy eres un chicom muy simpatico y7 ademas aces una linda pareja con la chica mas bonita y6 buena con gabriella a demas les kiero decir q su pelicula fuen linda muy romantico, todas las chicas estamos pensando k ustedes son enamorados x k asen una linda pareja bueno ya me tengo q ir bya troy y gabriella cuidense y a todo el grupo es lo mxm bye un beso para todos bye muxo besos su admiradora esteisi estefani bye amix .
Fecha: 2008-02-27 10:55:38

ashley escribió:
me encanta high school musical es bkn
Fecha: 2008-02-22 18:33:52

Alicia Moreno Liorente escribió:
De HIGH SCHOOL MUSICAL lo que mas me gusta es Troy Bolton o tonbien conocodo como Zac Efron esta buenisimo y boy a teatro Soy del colegio Las Gaunas.
Fecha: 2008-02-23 02:32:49

giovanna piño escribió:
que vanessa actuo muy bin en la pelicula dos de high school musical y en la ino mal
Fecha: 2008-02-23 10:58:04

monica escribió:
zac estas buenisimo me encanta ojala y un dia fueras mi novia me muero porti te amo bay besos bay chulo y presioso bay chiquito
Fecha: 2008-02-19 19:15:57

Fecha: 2008-02-20 10:06:23

nehy escribió:
high school musical es muy bueno amo a zac efron me encanta lo mejor besos shao
Fecha: 2008-02-20 12:11:11

aylen escribió:
hola!! a mi me encanta HSM y kiero ser como Shapay!!! Besos para todos y suerte!!! chauuuu!!
Fecha: 2008-02-20 15:33:18

sharito escribió:
hola este msj es para el mas churrrrrrrrro troy queria decirte q estoy super enamorada de ti osea me encantas tu forma de ser tus ojos todo puedes creer q se me declaran un monton d chicos y por ti no los acepto por que estoy esperando q vengas aca y me veas vas a ver q soy mejor q gabriellita montez y si me vez no lo vas a dudar ok tkm cuidate y besos sharon
Fecha: 2008-02-20 17:38:52

Jòrdiaah escribió:
m encaantaa high school musical 2.. corbiin blau stass kom un trenn ets un bombo sense paperr llastimma k no ens kuneguem i tinguis el doble d anys k joo!! xd uenuu i totss els de hsm sou mul mulonss.. us stm mul..vanessa, zac, monique, ashley, corbin..
Fecha: 2008-02-27 08:54:13

quet escribió:
te amo zac
Fecha: 2008-03-08 17:31:01

cony escribió:
Hola soy fans de ustedes y los veo todos los dias chao un beso para todos y un abraso muy fuerte chao
Fecha: 2008-02-21 09:39:48

miki escribió:
me apasione high school musical,me se todas sus canciones ... tengo todo de high school musical. asi,yo no me muero sin conocer a zac,vanessa,ashley,corbin,lucas y monique os kiero hsmmmm!!!
Fecha: 2008-02-21 11:14:47

claudia ascue lazo escribió:
high school musical es la mejor peli que e visto en el mundo y soy fanatica nùmero uno un beso a todos los que leen mi comentario bye.
Fecha: 2008-02-23 14:23:59

maria escribió:
high school musical es lo major me encanta ver high shool musical
Fecha: 2008-02-21 14:51:51

Ricardo A. Arias Salas escribió:
Hola quiero que pongan las películas de High School Musical 1 y 2 para verlas los fines de semana. ADIOS
Fecha: 2008-03-06 17:43:04

micaela escribió:
Fecha: 2008-02-23 18:35:29

vanessa escribió:
me llamo igual que gabriella a zac eres guapisimo.
Fecha: 2008-02-24 07:30:49

cristina gomez escribió:
Hola soy yo otra vez y os queria pedir un favor:¿Cuándo vais a ir a un pueblo de toledo(torrijos)?Vanesa quiero decirte algo eres super super super guapa y cantas mejor aun un pedazo beso a todos.
Fecha: 2008-02-24 12:53:43

Ricardo A. Arias Salas escribió:
Hola soy de Empalme Sonora México y quiero que pongan las películas de High School Musical 1 y 2 para verlas los fines de semana. ADIOS 05-Mar-2008
Fecha: 2008-03-06 17:49:21

Fecha: 2008-03-24 11:19:15

maria belen escribió:
high school musical y rbd es los mejor que hay en el mundo me encanta soy su majorfan !!! high school musical y rbd es lo mas!!!
Fecha: 2008-02-29 06:18:00

Lynda escribió:
Me encanta high school musical me gustaria verlos en la vida realchau Lynda Diana Pedemonte Vega
Fecha: 2008-02-29 09:14:11

mireya escribió:
hola soy mireya y me gusta mucho highschool musical por q' me gusta lo q' hace sharpy y troy
Fecha: 2008-02-29 09:48:52

CLARISSA escribió:
Fecha: 2008-02-25 23:31:28

CAMILA Y IARA escribió:
Fecha: 2008-02-29 10:59:53

juli escribió:
sos la mejor banesa te amo
Fecha: 2008-02-29 11:34:35

CARLA escribió:
Fecha: 2008-02-29 12:16:19

rocio escribió:
Fecha: 2008-02-29 12:31:41

corinna escribió:
high school musical 2 es lo mejor
Fecha: 2008-03-06 20:45:42

anonimo escribió:
olap me gustaria que hubiera iconos guiños fondos y juegos de ashley tidale que sean de cantar... bueno ojala lo pongan
Fecha: 2008-03-06 21:20:30

maria escribió:
bueno zac y ashley hacen linda pareja
Fecha: 2008-02-29 14:22:47

yohana escribió:
hla mis vidas km andan me rr koparon sus pelisssssss y stan buenisimas...... ls kiero dcir k zac es mio y k nadie m lo va a sakr.... k ls kd klaro xk sino ls rompo la kabza.... ZAC T RE AMOOOOOOOO SS EL AMOR D MI VDA....bueno mis amores spero k ls gustn mi msj.... chau los kiero muchisisisisimo aunk no los konoska.... chau un bsoooo... chau chau chau....
Fecha: 2008-02-29 15:52:12

dani escribió:
hola aca estoy con una amiga para su informasion yo etube con zac en el concierto y me dio su autografu y su numero chicas se los paso no se si ban a poder ablar con el pero se los doy .... (044811)583995328
Fecha: 2008-03-07 11:04:05

jesus manuel escribió:
hola high shool musical los quiero conoser vanessa estas vien bonita y tu zack suigue siendo guapo
Fecha: 2008-03-07 14:05:39

jesus manuel escribió:
hola high shool musical los quiero conoser algun dia
Fecha: 2008-03-07 14:06:43

renata salazar rosales escribió:
hola!!! pues yo solo quisiera decir que e encanto la pelicula y que zac y vanessa no se separen nunca y si no es asi aqui estoy yo bueno me tengo que ir besos mua mua!!!
Fecha: 2008-03-07 17:46:14

alba escribió:
es verdad
Fecha: 2008-03-01 08:47:59

alba escribió:
hay alguien ahi?
Fecha: 2008-03-01 08:50:07

Rocio escribió:
Hola high scool mucical soy su fans numero1 los re quiero sigan asi
Fecha: 2008-03-01 09:03:10

laura milena escribió:
hola high school musical los felizito por hacer unas pelicuñas fantasticas sobre todo a vanessa y ashley hacen un papel padricimo zac no dejes ir nunca a vanessa por favor si ok los amo a todos soy su gran fanatica llamenme al 2520518 y ahi me van a encontrar ok bye los ammmmmooooooooooo
Fecha: 2008-03-01 11:22:06

maria reyna escribió:
Fecha: 2008-03-25 17:21:56

jacke escribió:
linda es la gabriela y el troy tambien casi todos som lindos pero el cha tambien con su manera de comportase bien lidos y le agradesco mucho y cariño para siempre en mi corazon ya cuidatesen mucho ya
Fecha: 2008-03-25 18:13:59

maria escribió:
hola me llamo maria high school musical es mi favorito son todos ustedes y me gustaria verlos a todos ustedes prinsipal a grabiela soy fanatica de ella
Fecha: 2008-03-01 18:28:38

fiorela escribió:
hola chicos me encanta su programa y me encantaria conocerlos buenos los djs bye
Fecha: 2008-03-01 20:13:30

jairita escribió:
me encanta troy es guapo soy fanatica de high school musical 2 !TE AMO!
Fecha: 2008-03-07 21:36:16

ivone (de villa de santiago) escribió:
no pzz me gusta komo kntan tods y keria dcr ke muero x troy(zac efron)tengo muxoozz posters ke me han regalado de echo tngo una foto de troy bueno ya me voy x ke tengo kosaz pendientezzz TEEE @AaMO0O.................................
Fecha: 2008-03-02 08:45:45

jesus escribió:
k onda k soy de apodaca N.L. y megusta su programa y bueno si tu tienen msn me agregan bye
Fecha: 2008-03-02 09:28:30

gretta esther escribió:
hola troy es muy guapo super chevere lo amo mucho yo me paresco a gabriela es inteligente me despido mua,mua,mua muchos besos
Fecha: 2008-03-07 21:45:02

javiera escribió:
me gustan como actuan todos
Fecha: 2008-03-02 17:00:29

jose escribió:
TROY BOLTON TE AMO MUXO xfa agregenme en su msn XD
Fecha: 2008-03-02 19:04:22

ARIANA escribió:
Fecha: 2008-03-08 19:07:49

ROCIO escribió:
Fecha: 2008-03-03 10:11:30

jaquelyne escribió:
hola que bueno quen borraron todo lo de magdalena y diana y hacerca de las fotos de zac y de vanessa
Fecha: 2008-03-24 13:38:24

karina escribió:
ola me encanta high school musical adoro todas sus canciones y como bailan
Fecha: 2008-03-03 15:03:07

jesus escribió:
Gavriela es la mas guapa y a casa tengo las dos paliculas vuestras i que areis algun dia high shcool mussical3?
Fecha: 2008-03-25 08:13:43

emilia escribió:
holiis!! soyemilia y lo juegos de high shool musical estan copadicimos y amo a troy besos taty!!!
Fecha: 2008-03-04 14:22:22

mirleidis gomez escribió:
bueno mi fan numero 1 es vanessa me encanta como canta,como vaila y como actua mi sueño es conocerla algun dia besooooooooo a vanessa y espero algun dia conocerla chaooooooooooooooooooooo..............
Fecha: 2008-03-08 10:09:59

eliza escribió:
zac es un bombo no chicas?
Fecha: 2008-03-24 18:20:19

lucia belen escribió:
hay papi que guapo hermoso
Fecha: 2008-03-04 16:56:24

Fecha: 2008-03-04 18:35:55

rosa escribió:
hola como estan me encanta su musica y mi cuarto esta todo decorado de high scool musical yo soy gabriella y mi hermana es sharpay y mi novio es zac esta tan guapo que tengo un monton de posters de el ay quisiera que fuera mi novio lo deseo con todo mi corason buno pues bay besos
Fecha: 2008-03-04 23:24:43

ALEXS escribió:
hoa les deseo lo mejor en su carrera artistica soy su fans numero uno x lo cual aver si un dia me kieren visitar mi hermana es su fans numero dos los amamos tenemos todos desde una simple gorra hasta nuestro cuarto
Fecha: 2008-03-08 12:36:01

maria escribió:
me encanta zac es divino mas guapo que brat pit.BYE
Fecha: 2008-03-05 10:14:57

valeria del pilar llican medina y tengo 8 años escribió:
hola high school musical queria pedirles queme dieran su correo a mi e-mail pero ahi nomas esta mi correo y apate los adora cada vez que entro al internet entro a su pagina bay
Fecha: 2008-03-05 15:01:37

arantxa escribió:
es genial ºhigh school musical 1y 2 oigan me tengo q ir mañana o cuando pueda escribo '??????????? BAY
Fecha: 2008-03-08 12:58:04

paulina escribió:
yo quiero un juego enel q tenga q vestira un personaje y quien este mejor ropa gana
Fecha: 2008-03-08 14:05:24

Caroy escribió:
Hola ha mi gusta como canta Gabriela es lo mismo que decir Banesa ha yo me llamo Caroly en mi cole me llaman cari y soy POPULAR ADIOSSSSSSSSSSSS
Fecha: 2008-03-25 10:42:21

yessica escribió:
hola me re gusta las canciones siempre las canto y la pelicula esta re buena bueno sigan asi besos a todos chau yessi
Fecha: 2008-03-06 08:34:51

barbara zulli escribió:
high school musical es lo mejor, super los felicito por la mejor pelicula.
Fecha: 2008-03-06 09:25:23

VALDO escribió:
Fecha: 2008-03-08 15:51:29

maria pia escribió:
tos quiero mucho y les deseo mucha suerte y espero que agan otla pelicula
Fecha: 2008-03-06 12:13:47

jaquelyne escribió:
hola que cursi eres emelin osea que es eso y diana ymagdalena que bueno que quitaron sus correosssssssssssss oseaaaaaaaaaaa
Fecha: 2008-03-24 13:41:43

mariana escribió:
hola a todo de disney channel y de high school musical 2 chao
Fecha: 2008-03-25 16:34:00

daniela escribió:
hola soy daniela vivo en santiago de chile y lo unico que yo deseo es conocer en persona a los de hsm y ademas ganar premios disney despido desde chile danyy escribanme a mi mail
Fecha: 2008-03-09 09:55:43

barbara escribió:
es linda la vanessa y lindo el zac tambien ya chao saludos a todos
Fecha: 2008-03-09 10:53:24

raquel escribió:
hola me encanta
Fecha: 2008-03-09 11:36:14

pasquale escribió:
hagh scool musical siete grandi!!!!! sei bellissima SHARPEY
Fecha: 2008-03-24 15:08:32

aLe escribió:
Fecha: 2008-03-09 12:28:01

HAYDEE escribió:
Fecha: 2008-03-09 13:27:17

Arantxa escribió:
soy vuestra fan numero 1.m deseo es veros en persona i de mayor ser igual q vosotros os quiero un beso para todos los proyas i para los q an patricipado en el montage soy los mejores
Fecha: 2008-03-09 13:43:32

y@gaira escribió:
hola me gusta las pehooliculas de high scool musical 1y2 y gabriela y troy son lo macsimo y charpeyn y char chauuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
Fecha: 2008-03-24 16:33:15

kitikris escribió:
hola me gusta disney y me encanta high school musical
Fecha: 2008-03-26 15:19:47

karina escribió:
Fecha: 2008-03-26 16:27:53

cami escribió:
hola chicos los dejo bay
Fecha: 2008-03-24 13:07:40

ANDREA escribió:
Me encanta High School Musical he visto las dos peliculas y me han encantado.Tengo casi todas las cosas de HSM . Zac Efron , Vanessa Anne Hugens y Ashley Tisdale sois los mejores y los más guapos .
Fecha: 2008-03-31 13:48:31

melina minervini (meni marialena fuseneco) escribió:
hola a todo el mundo mandenme imeil quiero charlar con alguien tengo 15 años delen meli
Fecha: 2008-03-10 21:05:26

Estefania escribió:
Holaa Zac y Vanessa soy muy guapos,soy vuestra fan numero 1 porfa mandame elnombre de los finalistas del concurso "LOKOS POR EL BAILE" DE HSM2 plis que necesito saberlo porque yo participe y kiero saber kien son los finalistas.Chaoo oskm
Fecha: 2008-03-31 10:55:07

figueroa sofia escribió:
high scool musical fue una muy buena pelicula,y me gustaria ver la 3.
Fecha: 2008-03-26 19:45:04

carla escribió:
zac efron es el tio mas guapo del universo i vanessa tambien..... xxxxxxxxxxxxxaaaaaaaaaaaaaaau
Fecha: 2008-03-11 14:47:46

mailen escribió:
zac sos hermoso vanessa es la chica indicada para vos e`pero qº les valla re bien chau
Fecha: 2008-04-08 15:28:09

nicol escribió:
les dijo mi coreo x q quioero q me yamen los q quiero a ty gabnriela y a ty zac
Fecha: 2008-03-29 18:08:17

admiradora secreta escribió:
yo mega super amo a zac. Te amo un chin.... te amo nunca me pierdo ninguna pelicula donde sales tu te amo uuuuuuuuuuuuuuuuuuuun chin.... Espero algun di conocerte en persona te amoooooooooooo zac enfroy
Fecha: 2008-03-12 15:16:48

evelyn escribió:
hi!!!! ooo amo a zac efron♥ es lo maximo. y me fascinan las peliculas de high school musical. ojala y haya parte 3. uuuuuuuuuuuuuuuuuuuuuuuuu SON LO MAXIMO. BESOS...♥
Fecha: 2008-03-26 23:23:23

Alba escribió:
Tengo catorce años, y quiero decir que Zac está tremendoooooooooooooooooooooooooooo, y Vannesa es muy guapaaaaaaaaaaaaaaaaaaaaaaa . hacen muy buena, ¡Pareja!
Fecha: 2008-03-27 12:17:30

natalia escribió:
Fecha: 2008-03-12 21:04:24

Fecha: 2008-03-13 15:00:37

patricia escribió:
Fecha: 2008-03-14 05:09:54

genesis patiño escribió:
te amo zac efron te adoro eres mi idolo cuidate mucho adios.
Fecha: 2008-03-14 10:52:12

hellen escribió:
zac eres un idolo para todas chao te amo
Fecha: 2008-03-14 13:53:25

Fecha: 2008-03-14 14:10:58

marla escribió:
hola kisiera ser commo ustedes me gusta ZAC EFRON (TKM
Fecha: 2008-03-14 16:09:11

andreyna escribió:
tu eres lo mejor zac efron jugando basket yo tambien juego basket si leen mi comentario que agregen mi msn chaconandreyna_210@hotmail. sobretodo zac
Fecha: 2008-03-14 19:05:48

andreyna escribió:
perdo me equivoque en mi msn es
Fecha: 2008-03-14 19:08:10

karen escribió:
hola les digo que zac es re lindooooooo y gabriela jaja pero es que me pongo selosa de gabriela porque ella esta con ell y sabes que el es mi novioo :D jaja bueno les mando muchos saludos y suerte...
Fecha: 2008-03-14 23:12:37

andrea escribió:
mi sueño es verlos y troy es un papi demasiado lindo
Fecha: 2008-03-30 16:13:27

milagros belen meoni escribió:
troy essta re bueno
Fecha: 2008-03-15 05:50:13

oriana escribió:
hola high como estan bueno yo bien les quiero comentar que me encanto peli de high school musical 2 estuvo genial bueno chau losquiero mucho a todos
Fecha: 2008-03-30 20:25:10

Alvaro escribió:
Hola high school musical saves fui al musical en mi auditorio estubo jeniaaaal. los personages favoritos para mi son SARPEY y RAYAN me en canto la cancion FAVULORS un beso kaooooooooooooo
Fecha: 2008-03-15 12:56:34

Pamela escribió:
la palicula estaba muy linda deberian de ganarse el premio
Fecha: 2008-03-15 13:03:39

joselyne escribió:
hola quisiera saber cuando sale la pelicula de high shool musical 3 a de estar muy chida y a lo mej0r sale britney spers pero ojala que no salga porque britney no me cae muy bien que digamos y hacerca de gabriela estas muy bonita pero troy no se me hace tanto tan bonito como tu gabriela quisiera jugar juegos de ust pero no los encuentro bueno bay y recuerden es la pelicula que mas me ha gustado mi hermana es fans numero 1 de high shool musical al igual que yo bueno ba bayyyyyyyyyyy
Fecha: 2008-04-11 12:41:04

valentina escribió:
la peli está re buena ... bye ...
Fecha: 2008-03-15 15:57:38

juan luis escribió:
hola chicos como estan me gusstan sus pelicula y gaby bueno bayyy
Fecha: 2008-03-27 19:06:44

dulce escribió:
la verdad me gusta mucho zac porq es lindo y es super, mega, recontra, extra guapo
Fecha: 2008-03-15 18:10:27

juan sebastian daza vanegas escribió:
troy me gusta tu estilo, eres buen actor nunca cambies ese estilobay
Fecha: 2008-03-15 21:41:41

Kelys escribió:
Hula!! a todos...Me encanta High Scool musical, pero en especial Troy (Zac Efron) sos demasiado lendoooo!!!! TE AMOOOOOO...Felicidades y exitos para tu carrera amoor....SUERTE siempre deseando lo mejor se despide.. Kelyshita (Venezuela)
Fecha: 2008-03-15 23:01:48

marespa escribió:
hola chatis soys very buenos actores me encanta HSM zac estas muy bueno lucas corbin monic ashley vanesa soys estupendos xao besos enviatme vuestro mesenger guapos
Fecha: 2008-03-28 06:43:00

nayara escribió:
Laura eres la mejor igual que los de high school musical 2 Nayara
Fecha: 2008-03-16 05:53:18

hola xicos como estais,espero que bien soy una super fan buestra,y espero que sigais a si como siempre me ha gustado mucho lo buesto,pero ZAC tu eres el más guapo de todos,y haces una pareja ideal con VANESSA vosotros sois los mejores os quiero mucho ADIOS.
Fecha: 2008-03-28 07:58:27

brenda joncic escribió:
hola la peli de high school musical esta re buena la parte que se besan hace un eternidad que no se besaban por suerte, la parte el besos gabriela lo quiere besar un monton xq cuando callo el agua los dos estaba mirando el agua y gabriela lo agaro y lo beso de vuelta esta bien te son novios pero tampoco para tanto o no jajajaaja
Fecha: 2008-03-16 07:05:22

maica escribió:
que troy es guapo
Fecha: 2008-03-29 17:40:01

daiana escribió:
hola high school musical 2 esta re copada igual que la 1. zac y vanessa hacen una re linda pareja. si quieren tener fotos de zac tienen que poner zac. gracias bye bye
Fecha: 2008-03-16 20:06:46

andrea escribió:
me ha gustado mucho la pelicula
Fecha: 2008-03-17 09:01:52

MARTA escribió:
Fecha: 2008-03-28 13:14:52

valeria escribió:
amoa ZACK EFRON osea TROY el es el hombre mas bello del planeta tierra y me gusta como quedan el y vanessa juntos
Fecha: 2008-03-17 16:12:38

alexandra escribió:
me encantaria der como asley disdey y quiero un juego de ella y de los homber me gusta zac eron ya xaooo
Fecha: 2008-03-28 13:30:15

anna1 escribió:
para mi es una pelicula buena lastima q vanessa y zac se prostitueron
Fecha: 2008-03-18 10:37:17

marta ximenis amengual escribió:
Ola soi la fan numero uno de ashley,zac,vanessa,lucas,monique i corbin. Quiero vuesto mesenger sobretodo el de zac i ashley que son los que me gustan mas porque zac es muy guapo i ashley tambien.
Fecha: 2008-03-18 13:31:55

grecia escribió:
oas soy fan numero 1 de zac es lo maximo el unico tkm muas
Fecha: 2008-03-18 17:05:15

maria camila cardenal moreno escribió:
hola me llamo camila todos medicen cami,troy eres el chico mas lindo del mundo mis amigas y yo somos re fans tuyos y de gabriela todos los dias bajamos de internet fotos tuyas.
Fecha: 2008-03-18 17:20:53

rebeca araceli escribió:
hola chicos soy Rebeca me gusta su pelicula en espesial la de hig scool musical 1 los quiero mucho en especial tu gabriela y troy gabriela tu te vistes genial srarpei tambiem y troy me gusta sus canciones humuhumonukunukuapaa y tambien what time is your are the music in me,bop to the top,gotta go on my own ,strarof something
Fecha: 2008-04-02 18:03:54

mariel escribió:
Fecha: 2008-03-18 17:50:06

valentina escribió:
hola soy valentina me encanta high school musical esta sarpado a ver si vienen a maldonado!!!! los amo !!!!!!!!!!!!!!!!!!!!!!!!!! los re quiero cantan re bien besos
Fecha: 2008-03-18 18:12:31

mafer*** escribió:
high school musical es genial mis personaje favoritos son sharpay, gabriella y troy
Fecha: 2008-03-18 20:00:11

andrea escribió:
hola a mi me encanta zac y vanessa y tengo los albunes las estaspas las pelis sus discos el bolso de hsm tengo la mochila lo colresel juego para la play station de cantar bueno y adios asta mañana
Fecha: 2008-03-31 16:50:37

flor escribió:
hsm te quiero ashly tidale chau
Fecha: 2008-04-07 09:38:39

marta melero escribió:
hola zach eress el mas guapo del mundo
Fecha: 2008-04-07 12:12:50

mariana escribió:
hola como estan kuando ba salir la pelicula de high chool musical 3 bueno ya me boy astaluego le mando saludos ala sharpey al rayan ala gabriella ala teylor al chat y al troy tambien saludo y A todos un besotootee bay cuidense asta dios
Fecha: 2008-03-19 12:31:22

Mildred escribió:
Hola soy mildred y soy una fan de zac efron y de todos los integrantes de high school musical y los vi en Disney y le pedi un autografo a zac efron y Vanessa,a Lucas bueno y atodos los demas contando el beso que me dio zac en la mejilla!!Quiero que ya salga la pelicula de High school musical 3 ! y verla.. saludos
Fecha: 2008-03-19 20:39:08

claudia escribió:
ami me gusta mucho high school musical 1 y 2 espesial mente me gusta la dos cuando sharpeimt recapasita y ya no es creida y valora a las personas.
Fecha: 2008-03-29 22:50:02

gaby escribió:
olaaaaaa hig losss amooo son super vueno pa actuarr¡¡¡¡¡¡ya quiero que salgaa la peli 3 ashli te vistes tan vien vanessa eres una diosaaaa tee amooo zac eres bkn cordin eres vueno pa actuar y monic eres genialll......
Fecha: 2008-03-20 10:02:33

ndia acuña escribió:
hola soy nadia y tengo 12 años, soy fanatica numero 1 de zac efron es re lindo y lo re quiero es mi idolo, tengo todas las fotos te re super quiero zac, espero que me escrivas zac
Fecha: 2008-03-20 14:32:26

Arantxa escribió:
me encanta hsm mi sueño es ser como ellos ,verlos en realidad y que aunque digan otras niñas q son las fans numero uno yo sienpre delante suya aos kiero y todos los dias desde q me levanto asta q me acuesto pienso en vosotros y sueño con vosotros.
Fecha: 2008-04-11 13:24:06

perlitah escribió:
me gusta high school musical pero no tanto'''' es bkn'''
Fecha: 2008-03-20 15:53:02

ANDREA escribió:
Fecha: 2008-03-20 16:03:59

vicky escribió:
yo creo q hay q aber juegos donde se pueda jugar con zac efron por q soy su fan n 1
Fecha: 2008-04-23 13:57:30

daniela escribió:
me gusta mucho high school musical 1 y la dos y estoy inpasiente por que hagan la 3 me gusta zac vanessa lucas aschley son mis personajes favoritos de la pelicula pero la que mas me gusta es aschley besos y abrazos
Fecha: 2008-04-09 14:32:23

Arantxa escribió:
me encanta hsm mi sueño es ser como ellos ,verlos en realidad y que aunque digan otras niñas q son las fans numero uno yo sienpre delante suya aos kiero y todos los dias desde q me levanto asta q me acuesto pienso en vosotros y sueño con vosotros.
Fecha: 2008-04-11 13:23:38

joselyne escribió:
Fecha: 2008-03-21 11:11:55

EVELYN escribió:
Fecha: 2008-03-21 11:23:55

MEGAN escribió:
Fecha: 2008-03-21 11:29:35

vi@ney escribió:
me gusta high shool musical es mi mayor exito troy boolton y gabi
Fecha: 2008-03-21 13:41:42

EVELYN escribió:
ami me gu sta high shool musical 2y1 y tambien me gusta gabriela Y TROY Y CHARPEIN
Fecha: 2008-03-21 14:11:38

alexandra maley escribió:
me parece que high school musical a tenido mucho exito lo digo porque soy una de sus admiradoras
Fecha: 2008-03-21 16:46:26

milili escribió:
me encanta hsm es bkn pucha me encantaria conocer atodos especialmente a zac efron es un huchon es muy mino ''''''''''''' ya chau los quiero
Fecha: 2008-04-01 19:24:15

estefany escribió:
yo quiero la foto de vanessa de high school musical los quiero mucho
Fecha: 2008-04-12 11:43:47

melany belen escribió:
troy sos muy lindo y trabajas muy bien en la peli y a mi me gustas y mucho sos muy lindo, me imagino como deber ser vos en realidad besotes lindo te quiero chau
Fecha: 2008-03-21 19:10:18

Agustina escribió:
Hola chicos y chicas de high school musical les quería decir que me encantan sus 2 películas y las canciones tambien. Tambien les quería decir que Troy y Vannesa hacen una muy buena pareja,ademas tengo la peli de H.S.M 2 la versión extendida y me gustó muchísimo humuhumunukunukuapu'a.Les mando muchos besos a todos ustedes y espero que sigan filmando más y más películas.Chau,espero que lean este mensaje que yo les mando solo para ustedes...
Fecha: 2008-04-01 21:23:50

jose escribió:
los juegos de high school musical tambien se pueden en xbox 360 a y troy esta bien guapo puedes que el me conteste y mandarme su direccion por favor
Fecha: 2008-03-21 22:40:40

Flor escribió:
Zac Efon es re lindo. y soy la fans n 1 y todos los que sean tambien pue den conocerme
Fecha: 2008-03-22 09:08:39

paula escribió:
Fecha: 2008-04-02 08:05:48

Maria escribió:
Sabeis k soy fabulosas/sos me encantan buestro modo de expresar lo k sentis por las personas. dew
Fecha: 2008-04-02 08:17:47

sharon acosta escribió:
yo creo que deberia entrar vanessa porque ella hace todo mas dibertido como el hermoso troy y claro sharpay yengo mi cuarto lleno de sus posters soy su fan numero 11111111 osea unooooo
Fecha: 2008-04-02 13:36:37

sharon acosta escribió:
tengo 9 años porfa agan la peli numero3
Fecha: 2008-04-02 13:40:23

jazmin ochoa rodriguez. escribió:
yo pienso que no boy acomentar nada por que soy los mejoser y nada les falta por que son lo me joer
Fecha: 2008-03-22 16:26:41

jazmin ochoa rodriguez. escribió:
yo creo y afirmo que high school musical son de lo megor y actuan muy bien los felizito los quiro mucho soy su fan numero 1 ok chau A Y troy estas muY GUAPO
Fecha: 2008-03-22 16:38:21

Fecha: 2008-03-22 17:03:24

antonella escribió:
hola try sos ermoso te amo y me gusta como actuas ermoso
Fecha: 2008-03-22 17:05:30

sandy escribió:
a mi me gustaria ser novia de ZAC EFRON
Fecha: 2008-04-11 18:38:27

CAMILA escribió:
Fecha: 2008-03-22 17:39:55

vania escribió:
si es cierto que quiten las fotos feas de zac de google recueden que la mayoria somos niñas y si se ve muy mal que aparezca casi desnudo yo se que ese es su trabajo pero yo pienso que no necesita salir asi,el de todos modos es guapisimo.
Fecha: 2008-03-22 19:45:55

y@gaira escribió:
hola sois los mejoRES DEL Mundo troy me derrites eres LO MaXiMo y gabriel@ tiene suerte aunque me da envidia pr estar conEL Y HACERCA DE LAS FOTOS NO me inyeresza shaooooo
Fecha: 2008-03-22 19:52:59

emelyn escribió:
¨hola zac y gabriale los vi en un foto estan cool por favor madame una foto tulla plis ok
Fecha: 2008-03-23 17:02:37

emelin escribió:
mi amor zac te amo no hay otro hombre en mi vida te amo
Fecha: 2008-03-23 17:18:02

Rocio Fuentes escribió:
hola chicos me gusta mucho sus peliculas.
Fecha: 2008-03-23 22:06:32

esmeralda escribió:
hola como estan chicos me gustan sus peliculaz vayyyyyyyyyyyyyy
Fecha: 2008-03-25 14:27:00

elisa escribió:
ola,me encanta HIGH SCHOOL gustaria mucho conoceros en persona y sobre todo a TROY. adios y que todo as vaya muy bien como ahora
Fecha: 2008-04-03 10:32:24

andrea escribió:
troy quiero ablar contigo muuua beso
Fecha: 2008-04-03 15:47:37

GABRIELA escribió:
Fecha: 2008-04-03 19:02:05

karen lorena escribió:
hola me llamo karen Gabriela me gusta como actuas eres la mejor te felicito y saludos a Troy
Fecha: 2008-04-03 19:04:24

maria escribió:
a mi me encanta hanah montanna pero no se komo puedo coseguir el album porfaovr me podeis alludar??????????? a por cierto tengo unas entradas de higs school music y las puedo regalar mucho besos xao
Fecha: 2008-04-12 06:27:26

andrea escribió:
hola soy andrea me en canta high school musical 2 tengo todas las cosas para mi los mejores son zac vanessa os quiero mucho un beso.
Fecha: 2008-04-10 06:12:53

denis escribió:
los quieto
Fecha: 2008-04-04 12:44:57

sara escribió:
hanna montana te adoro queria k me dieras tu msn plis
Fecha: 2008-04-21 14:07:28

norma escribió:
hola zack como estas es sierto que te peleas te con la vanesa cuidate mucho
Fecha: 2008-04-04 19:01:04

camila escribió:
me encanta h.s.m admiro mucho a vanesa es muy buena adios contestenmen porfa vesos muaaaaaaaa
Fecha: 2008-04-04 20:24:20

jeison escribió:
si es vonita pero cuando sale high scool music y q les valla bien
Fecha: 2008-04-10 15:30:57

adriana escribió:
hola zac quiero ser tu novia y te requiero amor besos
Fecha: 2008-04-05 11:56:10

adriana escribió:
amor mandame una foto tulla se mi novio
Fecha: 2008-04-05 11:57:58

marce escribió:
hola que las peliculas de high school musical me han encantado.espero que saqueis otra.
Fecha: 2008-04-10 15:50:52

maria victoria escribió:
Fecha: 2008-04-12 07:59:01

PRISCILA escribió:
Fecha: 2008-04-05 17:21:57

tais rojas escribió:
me encantaria estar con troy y vanessa que es misuper amiga nosotras somos inseparables porque vannessa es mi hemanastra
Fecha: 2008-04-05 20:43:15

gianela escribió:
hola high cshool musical los quiero mucho¡¡¡¡¡¡¡¡
Fecha: 2008-04-05 21:12:23

laura victoria escribió:
me gusta mucho gsm . y me gustaria que a sharpein ;le pusieran un chico nuevo que entra en el instituto para que no se fijara en troy y gadriela vueno en fin es que troy esta guapisimoooooooooooo me gustaria conocerlo alguna vez espero que para el dia 29 de adril esten en paris para conocerle y pedirle un autografo os quiero muxo
Fecha: 2008-04-14 08:15:05

claudia escribió:
bueno io encuentro q el mas lindo es zack efron io lo amo ose a es la persona mas hermosa en el mundo ahhhhhhhh lo unico que quiero es conocerlo para comermelo a besossss ahhh io lo amo te amo ZACK EFRON io no podria vivir sin ver una foto de el todas las mañanas/ a y tambn me gusta corvin bluuee lo amo ahh io tengo una foto de zack y corvin en mi pieza son gigantes las foto ahhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh los amoooooooooooooooo muxo muxo muxox muxoo muxo muxo muxo muxo muxom muxo muxo
Fecha: 2008-04-10 21:11:33

sofia escribió:
hola chicos de high scholl musical 2 muchas felicidades a todos son fabulus muchos besos a troy byeeeeeeee
Fecha: 2008-04-06 00:26:15

jearelys escribió:
yo pienso que en high scholl mucical 2 deveria de tener mas duversion en la peli
Fecha: 2008-04-06 03:45:08

mar escribió:
chicos la pelilicula de hsm fu muy chula haver si sacais la tres muchos besso paraHSM
Fecha: 2008-04-06 04:00:43

nicole escribió:
me gustaria ver high scool musical
Fecha: 2008-04-12 11:17:50

paulo escribió:
high school musical es una de las palis más bonitas y divertidas espero que salga la tercera parte muy pronto.
Fecha: 2008-04-06 16:03:21

jessica escribió:
bueno ami me gusta todos los chicos los ano un besote umuaaaaaaaaaaaaaaaaaa LOS ADORO A TODOS
Fecha: 2008-04-14 10:22:47

GABRIELA escribió:
Fecha: 2008-04-21 17:36:48

lucila escribió:
me encanta jugar con high school musical es rre divertido
Fecha: 2008-04-12 22:46:48

angelly morales escribió:
soi la mejor fan de charpey y de gabriela
Fecha: 2008-04-14 13:43:40

martina escribió:
ZAC SOS RE LINDO!!!! me encantaria verte me encantaria que me des tu msn ya bueno quiero que todos me den su msn bueno!!!! me voy un beso a todos los kiero mucho y cuidense marty..//*
Fecha: 2008-04-22 12:56:57

monse escribió:
yo adoro a hsm pero como que enves de troy y gabriela pongan a troy y sharpein
Fecha: 2008-04-13 20:32:58

mariana escribió:
hola me encanto hsm 2 el mas guapo era zachari david alexander efrons y la cancion que mas me gusto fue la de work,everday y all for one.
Fecha: 2008-04-22 13:05:35

rocio escribió:
hola ashley me guataria queme des tu msn el de zac tanbien elde todos me encanta la peli esla megor y me gustan los juegos del libro me firmaste gracias chau ♥
Fecha: 2008-04-22 13:33:47

nayeli escribió:
ola!!! yo adoro a hsm y esta bien buenote troy y lucas ojala q algun dia vengan a enenada baja california yo iria asu consierto y pagaria 1000000 pesos por estar en mero enfren jeje se q estoy un pikito lokitap pero asi soy yop jeje bueno bye t.q.m zac y lucas los amo
Fecha: 2008-04-14 20:50:07

jennifer mariana escribió:
hola: soy tu fan numero 1 zac efron te amo
Fecha: 2008-04-14 22:46:37

Génesis escribió:
hola que tal me gusta high school musical 1 y 2 es jenial
Fecha: 2008-04-22 17:31:12

daniela escribió:
este troy es mucho mas guapo k gabriela
Fecha: 2008-04-22 20:41:36

Maria Paula Muñoz escribió:
Fecha: 2008-04-15 19:36:37

ARIANNA escribió:
VANESSA eres la mas guapa pero ten cuidado de no irte borracha para que no te vuelvan a poner a la carcel i tu zac en la peli 2 de hsm ten quidado con lo que dices espero y estoy deseando ver high school musical 3
Fecha: 2008-04-16 14:09:55

adriana marcela franco herrera escribió:
hola Zac me muero de emocion tueres un papacite y estas muy buenooooooooooooooooooooooooooooooooooooooo
Fecha: 2008-04-16 17:09:21

marcela escribió:
hola me encanta hsm soy la fan n.1 de ashley tisdale bye escribanme
Fecha: 2008-04-16 17:23:12

gonzalo escribió:
hola vannesa te amo
Fecha: 2008-04-17 10:54:20

Carla escribió:
A mi me gusta todo lo que tengo de las pelis, creo que hay invertido mucho trabajo y esfuerzo porque las cosas no salen de un dia para otro.Yo no tengo ninguno preferido creo q todos lo hacen fenomenal
Fecha: 2008-04-17 11:56:08

sara escribió:
es la pelicul mas vuna del mundo los amo
Fecha: 2008-04-17 13:01:37

veronica escribió:
a mi me parace mas guapo corbin blue esta mas bueno ademas me encantan sus canciones
Fecha: 2008-04-17 13:45:46

yazmin escribió:
troy es guapisimo aparte gabriela igual esta gupisima a y ojala y pudiera conocer a todos los de haigh shool musical
Fecha: 2008-04-17 14:35:21

ONELLCRYS escribió:
Fecha: 2008-04-17 19:02:09

marta escribió:
te queiro zac
Fecha: 2008-04-18 07:43:12

rosario escribió:
hola hsm mencanta la peli de la la unoa y la dos y ojala que les baya bien enla tre y se lo de se o de todo corason todos lo de hsm megus tan como actuan ylos personages que megustan ami son.. troy,gabiela,sharpey,brayan,chat y taylor bay que que les baya bien en la peli tres bay y soy sufan numero uno y mayamo sharo
Fecha: 2008-04-18 10:30:43

maria escribió:
troy estas como un tren soy yo maria una fans tuya y tengo 10 años me gustaria q vinieseis a mi pueblo... a y una amigua mia se alucina contigo... bss vanessa
Fecha: 2008-04-18 11:39:00

paula escribió:
hola me llamo paula i que lo sepais que sois unos artistas i tu troi esaaaaaas como un tren i tu gabriella eres guapa i quiero de grande ser como to deeeuuuuuuuuuuuuuuuuuuu
Fecha: 2008-04-24 13:48:05

Cristina Hernandez escribió:
Me encanta High School Musical quiero dar mi boto a las Twin Sisters ¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡Todos lo haceis genial.
Fecha: 2008-05-06 13:31:33

raquelita escribió:
Fecha: 2008-04-19 08:48:46

leslie maricielo escribió:
sabes el lunes es mi cumpleaños
Fecha: 2008-05-03 12:06:00

romina escribió:
zac sos el mas lindo de todos pero no tanto como lucas vanessa cuidate capa pero no te creas que sos la mejor la mejor es ashley los quiero a todo en especial a lucas y ashley cuidensen besos romi
Fecha: 2008-04-25 21:21:12

mayka escribió:
troy es guapo
Fecha: 2008-04-24 19:45:44

francis abril escribió:
hsm es genial me encanta las canciones y los bailes. los sigo siempre y quiero a todos.besos los quiere francis abril con amor.bay bay!
Fecha: 2008-04-19 15:18:30

PAMELA MARIA escribió:
me encantaria ablar com voz
Fecha: 2008-04-19 18:10:15

LaXpazz escribió:
amo a ashley tisdale es la mejor es la mas linda de todo el mundo
Fecha: 2008-04-19 18:18:32

carla escribió:
me encantan vuestro juegos a se me olvidaba buen estrano de la peli de high school musical 3 besos a vanessa y a zac sobretodo
Fecha: 2008-04-20 14:04:13

ana escribió:
Fecha: 2008-04-20 15:21:56

Noelia Maria escribió:
zac ¡estas buenisimo!
Fecha: 2008-05-19 08:32:25

LESLY escribió:
High School Musical me gusta mucho, tambien las canciones pero la pelicula que me guusto mas es la 2 y hay una cancion que se llamma `` We`re allin this together `` adios chao.
Fecha: 2008-05-03 19:20:01

Pamela escribió:
Me gustaria ser un integrante de ``high school musical``
Fecha: 2008-05-03 19:25:33

anelis escribió:
hola troy como estas
Fecha: 2008-04-26 14:22:30

juan luis escribió:
hola sois los mejores yo esstoy en la escuela jesus reyes heroles en 5.3 bueno te quiero gabriela saoo
Fecha: 2008-04-26 17:10:38

michelle escribió:
hola estoy muy bonita al igual que troy aunque gabriela me cae mal y pues no lo puedo evitar asi que nimodo bueno ba ba bayyyyyyy
Fecha: 2008-04-26 17:13:57

juli escribió:
hola lucas o sea raian es un bonbon y lo rre amo y mata como actuas a troy se un palo andante jajajajaja un beso july
Fecha: 2008-04-27 06:46:14

valeria escribió:
a mi me gusto hsm2 y espero que muy pronto saquen hsm3
Fecha: 2008-04-27 11:29:28

maria cecilia escribió:
holaaa gabriella como andas soy una nena de 8 años me encantan las cansiones de vos con troy y la de all for one y cuando te vas
Fecha: 2008-05-04 13:45:20

pepi escribió:
high school musical me gusta mucho tendrian que poner juegos de vestir decorar cosas de ellos sobretodo de la Vanessa tengo muchas amigas que pueden consultar la wep el 1 de mayo mirare la wep espero que me allais echo caso.
Fecha: 2008-04-27 14:27:49

ludmila escribió:
hola los amo atodos les dejo mi coreo los amo chausito hojala que me contesten los amo
Fecha: 2008-04-27 21:00:49

Estefania escribió:
Soy estefania kiero decir ke voten a las gemelas porke se lo merecen ,lo hacen muy bien me encantan como hablan son muy educadas las QUIEROOO!!!!:)
Fecha: 2008-05-04 14:24:17

victoria escribió:
zac Efron sos un divino total cantas re bien una amiga mia te ama
Fecha: 2008-04-28 12:09:23

barbara escribió:
bueno mi personajr faborito de la peli es la asley (sharpay evans) y bueno y de los hombres obiamente al zac efron (troy bolton) son mis dos favoritos bueno ese era mi lindo comentario concepcion-chile
Fecha: 2008-04-28 18:56:08

k@r3n escribió:
zac efron es lo maximo y es guapisimo
Fecha: 2008-04-28 23:08:45

camila escribió:
zac eres tan guapo que asta me casaria contigo
Fecha: 2008-04-29 09:41:11

paloma jaque escribió:
Fecha: 2008-05-04 18:57:18

ARELI escribió:
HIGH SCHOOL MUSICAL sus 2 peliculas han sido de lo super es lo super los quiero muchisisimo hasta luego y que tengan exito en su proxima pelicula.
Fecha: 2008-04-29 12:16:22

fergie escribió:
holizz bueno yo pensaria que deberia aber un juego en donde eligan un personaje de hsm2 y lo vistan y eligan su musica o que la inventen y que despues pueda ir a recitales eso seria lindo y bueno eso nomas era chau
Fecha: 2008-04-29 18:56:40

fergie escribió:
bueno me olvide de desiste que troy es un divino es lo maximo y bueno plis agan ese juego plis
Fecha: 2008-04-29 19:11:15

Lily 2 escribió:
Gabriela I am charmed with you and zac efron is my fan nº1 and ashley me an said often that I look like you good-bye handsome(pretty)
Fecha: 2008-05-10 04:48:19

gabriela escribió:
HoLa!¡ bueno me encantaria verlos en personas son lo mejores mas vos try y gabriela y todos los amo emmmmmmmmmmmmm. bueno no se qeu decir baybay ah TROY te amo!!!!!!!!!!!!!!!!! soso el mejor de todos bueno pero ke los otros no se pongan celosos jajajaj te rr rr rr r r r r r r amo amo amo amo amo bueno troy soso divono star te amo
Fecha: 2008-04-30 22:51:14

Alba escribió:
chicos os quiero soy vuestro mayor fan y os deseo una muy feliz carrera artistica si seguìs en esa carrera y si no tambien porque soy fastanticos de verdad bueno soy alba y os quiero un monton sobre todo a vanessa anne hudgens, ashley tisdale y zac efron son los mejores de la tele y sobre todo los mejores actores de toda la eternidad y tu zac efron porque has hecho un monton de peliculas como hairspray y tu vanessa anne hudgens tambièn y tambien has hecho un montyon de obras de teatro como el mago de oz y buenos adi9os os quiero un monton
Fecha: 2008-05-01 05:16:56

carla escribió:
megusta troy sharpey y gabriela bisten bien son guapos yy todo eso son guais y sai no vtegustan natalia tegusta te aguantas vale y punto vale natalia para todos tam bien ya esta feos y feas adios... xao...
Fecha: 2008-05-10 12:55:29

atteneri escribió:
a mi me gusta vannesa por ke es super guapa es simpatica con todo el mundo igual ke zac por se eenamoraron yo pregunto se iran a casar alguna vez´`´
Fecha: 2008-06-02 08:32:29

ariannys escribió:
troy bolton eres guapote mira te amo co tu no tienes idea
Fecha: 2008-05-05 20:43:07

silvia escribió:
soy una de tus fans numero uno adios guapo
Fecha: 2008-05-02 10:21:45

angel escribió:
estuvo de marabilla me encanto se ve maravillso
Fecha: 2008-05-02 12:46:58

gabriella escribió:
me encanto las dos pelis, fueon de lo mejor, me encantaria saber sus e-mails , sus numeros telfonicos, sus direcciones y ya decearía q salga la peli 3 q debe de ser super chebre y muy muy pero muy bonita
Fecha: 2008-05-02 14:52:37

Maria Gomez Cordero escribió:
Soy mery solo kiero decir a la gente ke en locos x el baile deberiais votar a las dos gemelas!!!!Y vosotros los protas de HSM y los ke no sois protas pero estais enla peli keria deciros ke lo estais aciendo genial,xq la gente no sabe el trabajo ke aceis!!!!!!!!!!!!!!!!
Fecha: 2008-05-02 15:16:47

yuri escribió:
son geniales todo pero en especiales sharpay y troy me encanntan como trabajan los dos son de lo maximo !!!!!! soy de venezuela _ estado sucre espero que me contesten algun dia xaito troy eres super biurifful te amoooooooooooooooooooooooooooooooooooooooo!!!
Fecha: 2008-05-13 16:46:26

alejandra escribió:
troy estas bien guapo heres mi novio y te quiero estas bien guapo daaaaa
Fecha: 2008-05-07 20:38:48

geraldin escribió:
hola mando saludos a todo al mundo
Fecha: 2008-05-07 21:36:12

marilo escribió:
hola mellamo marilo. hola zac guapo comoestas como un bonbon
Fecha: 2008-07-16 03:57:40

Anabel escribió:
Hola,soy una fan de high school musical, me gustan todos los personajes pero los que mas : GABRIELA Y TROY BOLTON!!!. LES MANDOOOO UN BESOOOOO A TODOS,CHAUU.
Fecha: 2008-06-24 09:17:36

ana escribió:
me encanta ashley tisdale ke hace de sharpay evans en high school musical,y tambien hace de madie fitfpatric en hotel dulce hotel las aventuras de zac y cody.tambien me encanta hannah montana y los magos de waverly place , es decir me encanta disney channel,pero la persona ke me gusta mas de disney channel es ashley tisdale,es la mejor!!!!!!!!!!!!!!!y me encanta como viste ,canta,baila y actua.
Fecha: 2008-05-08 13:14:25

maria gloria escribió:
troy me parese muy bonita troy te digo algo tu eres novio de gabriela si lo eres estas loco porque gabriela esta demente
Fecha: 2008-05-08 13:59:52

lili escribió:
vanessa eres la mejor del mundo eres muy dulve y cantas muy bien tu mejor amiga es asheley y monic byebye.
Fecha: 2008-05-08 16:15:00

Wendy Karen y Monce escribió:
Hola chicos de zaping zone quiero decirle que la pelicula estubo padre a y que hayga juegos de high school mucical 2 los quiero mucho bye cuidanse y e chenle muchas ganas us te des pueden cuidense besos adios bye.
Fecha: 2008-06-13 18:48:47

Alba Ibañez Adalid escribió:
Quiero que sepas que soy tu fan numero1 Zac. Te quiero besotes grandes
Fecha: 2008-05-10 13:19:20

celia escribió:
habeis exo una peli alucinante me a gustado muxoo!! pero e oido decir qe la proxima peli vanesa no saldra pues qe royo!! estas buenissinimo zac!! att:las valleras
Fecha: 2008-06-01 03:30:27

victoria escribió:
hola soy victoria tengo 7 años de edad me encanta el high scholl musical me gustaria que pusieran juegos de vestir y maquillar soy de venezuela garcias los quiero
Fecha: 2008-05-15 11:05:22

lisseth escribió:
Fecha: 2008-05-10 13:33:21

lola escribió:
olita soy lola kiero decir k zac esta como un keso y kmevoy adios okm
Fecha: 2008-05-11 14:09:36

Carla escribió:
Troy esta como un tren y sack y cody tambien me encantaria ganar el procsimo concurso High scool Musical2 y Hanna Montana es guapisima ogala fuera estrella como ella y tambien Jeic raian es guapisimo y ogala conociera los que salen en disney channel .
Fecha: 2008-05-11 15:24:27

luna escribió:
Troy:Te amo y sos el amor de mi vida si te pasa algo me muero o mas vale me mato tengo 18 años contestame en 5 meses
Fecha: 2008-05-11 20:39:29

wilma pino escribió:
que todo es genial y divertido,y espero que sigais asi un beso
Fecha: 2008-05-12 08:47:49

pol escribió:
me gusta todos los programas de disneychannel i de high school musical mi personaje favorito es chad i de chica la taylor esta muy buena me aria el amor con ella
Fecha: 2008-05-12 12:15:43

gabby escribió:
kiero dcir ke el zac esta muy bueno y ke la vanessa esta muy linda la ashley es muy buena tu lucas sigue asi pero vistete mejor vengan a chile
Fecha: 2008-05-16 15:50:33

maria guadalupe escribió:
zac efron estas guapisimo corran a vanessa por haberte plantado y desnudarse enfrente de lucas grabiel y dreke bell vanessa es una odiosa la odio y yo dijo que tu y ashley deberan seguir saluendo asta luegoooooooooo
Fecha: 2008-05-12 18:28:56

yamile escribió:
gabriella creo que zac es hermoso y forman una bonita pareja
Fecha: 2008-05-16 20:00:55

ainoa escribió:
espero k me dejeis algun comentario bss
Fecha: 2008-05-31 07:59:45

ainoa escribió:
espero de lo k aiga escrito me contesteis mandare unos mensajes dew asta pronto
Fecha: 2008-05-31 07:03:53

nayara escribió:
hola,me llamo nayara me encanta mucho high school musical 2.Los de high schoo musical son los mejores del mundo y de disney channel.El año pasado me metia muchas veces aqui pero desde qie me quitaron disney channel no los he visto mucho.No los olvidare nunca. Muchos besos NAYARA LES QUIERO MUCHO NO LES VOY A OLVIDAR NUNCA EN MI VIDA.
Fecha: 2008-05-17 07:07:17

Fecha: 2008-06-13 08:52:08

ainoa escribió:
a mi me gusta high school musical antes le keria al zac pero ahora no ahora le kiero a el diego de 3+2 sii deseas ablar com migo ten mi msn tengo 9 años naci en junio el dia 23 el dia de la berbena en el año 1999
Fecha: 2008-05-31 07:00:40

patricia escribió:
hola soy patricia quiero que sepais que lo tengo todo y lo de la prensa tanbien meduele ver a mis fans sufriendo por la prensa y poder tener una relacion privada lo siento yyyyyy animos.DE VUESTRA AMIGA PATRICA........TKM!!!!!!!!!!!
Fecha: 2008-05-17 11:42:22

absle veronica escribió:
me gusta muxo zack efron okas
Fecha: 2008-05-17 13:27:58

karla escribió:
Hola Troy como esta espero que te encuentres bien de salud espero msj este es mi correo bayyyyyyyyyyyyyyyyyy te cuidas besos
Fecha: 2008-05-30 21:27:26

guti escribió:
ola soy l mejor fan de la historia que ha tenido zac ,gabriella soys los mejores
Fecha: 2008-05-18 08:34:52

almu i maria escribió:
ola somos de beniarres (alicante)en el kual ai muxas cosas komo la peña del Benicadell,La cova del 9 forats i la de l´or , el Barranc de la encanta el kual a i una leyenda de un fantasma k sale cada 100 años si kieres + info. ven a Beniarres , solo keriamos decir k nosotras no gustaria grabar 1 disco i acerse famosas y k Zac (Troy) es muyyyyyyyyyyyyyyyyy wpo.
Fecha: 2008-05-18 10:21:57

eva escribió:
me emcanto la primera la segunda y sobre todo me entusiasmara la tercera va a ser GENIAL!!!!!!!!!!!!!1
Fecha: 2008-05-20 11:03:29

evelyn escribió:
hola soy Eve y me encanta zack y cody gemelos en accion estan re buenos los capitulos, me encantaria verlos a los dos en persona y ser su amiga ¡Me fasina Cody!
Fecha: 2008-05-28 19:38:43

Fecha: 2008-05-20 17:16:41

Fecha: 2008-05-21 11:42:59

MIRIAM escribió:
Fecha: 2008-06-13 14:09:21

marilo escribió:
hola mellamo marilo. hola zac guapo comoestas como un bonbon
Fecha: 2008-07-16 03:59:28

laura martin diaz escribió:
hola soy laura y tengo 8 añosy me gusta mucho haigh school musical y mi personage favorito es troy y grabiella y quiero que me deis vuestro msn el mio es asi
Fecha: 2008-07-16 07:03:39

paola escribió:
te amo troy
Fecha: 2008-05-22 18:49:49

javiera escribió:
este juego me encanto ademas ke a mi me encanta hsm porke es una de las peliculas mas buenas ke e visto en toda mi vida bueno ademas de hsm el desafio ke son dos peliculas muy buenas me se sus nombres verdaderos ademas de los de la peli gabriela:vanessa troy:zack chad:corbin sharpay:ashley ryan:lucas xauuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu gracias por ser la pelicula mas buena de todo el mundo xauuuuuuuuuuuuuu se despide javiera la princesita ke los kiere muxo xauuuuuuuuuuuuuuuu
Fecha: 2008-06-13 15:07:41

Antonella escribió:
hola son re lindo los quiero mucho chau Anto
Fecha: 2008-07-18 17:32:22

camila escribió:
hola me encanta high school musical tengo todo de high school musical aparte casi quiero tener la pelicula 3 de high school musical porque esta buenisimo bueno un beso enorme cami bye....
Fecha: 2008-05-23 12:24:45

gabriela escribió:
tengo7 años y me encanta esta pelicula y mimama tiene 30 años y mi papa tiene 31años y mi personaje preferido es troi
Fecha: 2008-05-23 12:52:44

kokii escribió:
me encanta high school musical 2!!! y a quien no les gusta zac! .. admitanlo chicas nadie odia a zac no ? es precioso lo amo con todo mi corazon estoy esperando hsm 3 y ojala que estea zac tmb buenops besotesss cuidenseee msn: bchosss
Fecha: 2008-05-23 18:20:00

noelia y picon escribió:
zak te amo eres un sol.¡¡¡!!! gabriela te xero mx mx¡¡¡!!! te odio sarpey no pienses k le vas a kitar a gabriela su niño gabriela cuando dejes a troy me lo das a mi vale?¿ xdxdxd am tenga 11 años y soi de cadi
Fecha: 2008-05-24 06:55:27

valentina escribió:
los juegos son reeee buenos. los personajes son muy paresidos. pero los que piensan que gabriela es guapa son muy tontos. pero los que creen que ashley es linda estan con la razon. xau que esten bien.
Fecha: 2008-05-24 11:50:33

fransheska escribió:
hola todas las de mi curso te admiran incluyendome a mi y tambien les encantan las canciones .
Fecha: 2008-05-30 10:37:18

sayra andrea caceres caceres escribió:
hola soy la sayra
Fecha: 2008-05-30 15:41:34

belen escribió:
hola esta re buena la pelu son lo mejor q e visto los quiero mucho a todos ustedes tambien estan re bueno algunas partes de la peli no me gustaban pero la verda estaba buena lapeli esta supe les mando un beso a todo los de high school musical y los amo a todos los quiero mucho .....belen...
Fecha: 2008-05-25 00:46:04

OD@LIS escribió:
Fecha: 2008-05-25 10:51:14

maria camila quintero escribió:
me encanta mucho hig school son lo maximo no se si las otras niñas lo han notado pero hig ha cambiado mucho desde la 1 pelicula que fue hig school musical 1
Fecha: 2008-05-30 16:39:03

stephanie escribió:
hola soy Stephanie la ke ve mucho su programa oigan no es mucho pedir el msn de todos porke los admiro y los apresio mucho y kisiera conoserlos mas porke no basta con onoserlos por disney chanela isi pueden envienme fotos
Fecha: 2008-05-30 20:24:03

marieth escribió:
zac es muy guapo lo amo y sharpay es una que bueno pues brayan es guapisimo gabi quiero ser tu eres muy hermosa y si quieren estoy conectada por fa hablen conmigo
Fecha: 2008-05-26 18:40:56

marieth escribió:
Fecha: 2008-05-26 18:51:47

triciakoketa escribió:
oigan si ono k esta guapo zac es un bonbon de asucr y no se olviden de gabi es guapa linda y talentosa igual todos ¡¡¡ eee no se me olvidan bueno ya me voy y los de high scool mucical me ablan heeeeee bueno bye.......bye.....bye......bye........bye...
Fecha: 2008-05-26 19:50:05

silvana escribió:
te amo Zac
Fecha: 2008-05-26 20:36:23

esmerlda guzman silva escribió:
amo alos de high school musical yo tengo sus dos peliculas originales
Fecha: 2008-05-26 20:43:18

alba escribió:
a my tanbien mme encanta muchisimo high school musical me encantaria conocerlos en persona y sobretodo a zac y a vanessa me encanta¡viva zanessa y high school musical!
Fecha: 2008-05-27 14:32:44

judiith_ermozza escribió:
troy te amo eres el amor de mi vida hsm estuvo muy chido tambien estubo muy bien la 2 me pasas tu hotmail troy vanessa ashly lucas chad teylor marta quelsi quiero ser su amiga adios a todos los quiero mucho.
Fecha: 2008-06-02 12:51:56

Arely Debanhi escribió:
ps la vdd soi una de las fans numero *1* de hsm la peli la tengo en vercion extendida me fasina traee todo sobre hsm y aprobechando te amooooo *ZAK* eres super guapo el mas guapo de todos y judiith cmo kres ke te van a dar su correo wauw ke mal stas jaja en fin te amo y no me importa lo ke diga la gente tengo un poster, las dos pelis la 1 y 2, 3 libros grandes de calcomanias de ZAK, fotos imagees de ellos, todas las canciones en el cel el disco de hsm 2 y muchisimas cosas mas......... *********TE AMO ZAK EFRON TE AMO***********
Fecha: 2008-06-02 16:59:49

marilo escribió:
hola mellamo marilo hola zac guapo comoestas como un bonbon
Fecha: 2008-07-16 03:57:19

jazzel escribió:
Fecha: 2008-07-15 22:34:52

MªJose gomez varo escribió:
me encata high scool musical es la megor pely k e visto y espero k sea asi para toda la vida.¡ZANESSA ES LA PAREJA PERFECTA!(soy de barbate)
Fecha: 2008-06-14 10:24:55

mariisela escribió:
hola soy su admiradora bueno cuando ba a salir la 3 por pue ya la puiero ver bueno ya me boy bay
Fecha: 2008-07-16 17:26:51

melina jalda escribió:
hola no se si son los berdaderos de highscool musical poeque ustedes hablan en ingleS!!!!! no confio mucho pero...!!! si son ustedes!! q no creo .... los atmiro los re quiero me encanta como actuan son los mejores me encanta !!!!! la peli !!!!!! son los mejores espero q salga asta la peli 6 o la 7 estaria re demas q sigan los re atmiro !!!!los amo !!!!!ZAC !!! estas re lindo sos un bombon ... te recomiendo algo !! ... no te cortes el pelo !!! plise !! te queda bn el pelo largo!!!!!! te estoy ablando desde unuguay !!!!!!!!!!!
Fecha: 2008-06-03 20:45:49

Romina giossa escribió:
Soy la mejor fans Te amo Zac
Fecha: 2008-06-04 09:52:09

jocelyne escribió:
hola soy jocelyne les queria decir troy pareces jotito y vanessa no me gustan las fotos donde sales desnuda o con poca ropa y eso desepciona porque la mayoria somos niñas y sus fans y no creo que sharpay haga eas cosas ella si es educada y chat me facina tu cabellera y taylor eres bonita pero baja de peso bueno me despido baaaaaaaaaayyyyyyyyyy jocelyne
Fecha: 2008-06-14 14:03:57

anais muñoz escribió:
ustedes son lo mejor zac estas bueno espero que algun dia te vea pero son lo mejor de la televisión chao y son mis favoritoa att.anais muñoz
Fecha: 2008-06-15 07:35:45

miriam escribió:
ashley eres la mejor me encantas en to tengo todo tus discos y eres super guapa ojala te pudiera ver en persona
Fecha: 2008-06-04 13:38:51

ANA escribió:
Fecha: 2008-06-04 16:56:32

MONSERRAT escribió:
Fecha: 2008-06-04 17:58:07

MARIANA escribió:
Fecha: 2008-06-04 18:02:10

anyelina escribió:
soy 1 SupeR Fan d HsM tenGO la HAbiTAcion LLEnA D pOSters.y tODos sON Muy WaPOS!!!
Fecha: 2008-07-16 09:01:51

Vanesa brighid escribió:
esta super el sitio felicitaciones
Fecha: 2008-07-16 10:55:43

noe escribió:
me encanta hsm
Fecha: 2008-07-10 12:21:52

bianca escribió:
hola troy sabias que sos muy lindo
Fecha: 2008-06-05 19:35:50

Martha Abish Anguiano Sànchez escribió:
me gusto mucho la pelicula y yo creo q vanesa es muy bonita
Fecha: 2008-06-06 10:39:13

sarpy escribió:
high school es lo mejor
Fecha: 2008-06-06 10:57:22

vicky escribió:
me encanta muchisimo high school musical me parecen unas peliculas muy entretenidas y muy divertidas y x cierto me encantan las canciones.
Fecha: 2008-06-06 12:28:49

maria camila quintero escribió:
bueno me encanta hig school musical porque es muy divertido y ademas me gusta zac es lindo y me encanta jugar con el los amo mucho a vane a rayan asly tisdey a monique a corbin y por supuesto a zac
Fecha: 2008-06-06 19:31:28

GENESIS escribió:
Fecha: 2008-06-06 22:00:01

estefanny giscelle ordaz rdz escribió:
ola se me ase fantastico su peli de hsm
Fecha: 2008-07-10 00:44:04

mariisela escribió:
hola soy su admiradora bueno cuando ba a salir la 3 por pue ya la puiero ver bueno ya me boy bay
Fecha: 2008-07-16 17:26:09

aracely escribió:
la neta zak esta bien guapo y gabriela esta bonita asen muii bonita pareka jaja...baI
Fecha: 2008-07-10 13:51:21

LUCIA Y PAULA escribió:
Fecha: 2008-07-18 16:12:56

yuslaimy yazney jaimes arango escribió:
Hola soy yusleimy desde colombia les que swon los mejores cantantes de toda mi vida mi mamá me compro el sidi de su musica y la escucho todos los dias la musica de la pelicula 1 y la 2 chaoooooooooooooooooooooooooooooooooooooooo. fecha:2008-15-06
Fecha: 2008-06-15 18:28:31

el rata escribió:
todos los de high school mucical son unos estupidos locos de la madre pedaso de locas
Fecha: 2008-06-15 19:09:51

Wander escribió:
Me Gustan todos los prgramas de Disney Channel
Fecha: 2008-06-15 19:13:49

ginger escribió:
me gustaría n juego new pr el ordenata the HIGH SCHOOL MUSICAL 2 cn TROY
Fecha: 2008-06-09 13:20:08

GINGER escribió:
Fecha: 2008-06-09 13:40:11

janis spuler escribió:
zac efron te amo soy tu fans number 1 osea off cos llego a soñar con tigo xaus
Fecha: 2008-06-09 17:15:22

paola michell escribió:
zac estas super guapo soy tu fan numero 1 zac y michellforever and ever por siempre cariño te amo si te tubiera emfrente te comeria a vesos eres un biscocho besos.
Fecha: 2008-06-09 17:20:34

anna escribió:
hola troi es el mas uapo me gusata las pelis aora la 3 creo ce me gustara
Fecha: 2008-06-25 09:34:45

daniela ypor otro quiero ser como sharpay escribió:
shapay quiero ser como vos ylo voy aser tenes msn me lo pasas
Fecha: 2008-07-09 21:33:44

vanesa escribió:
zac te adoro te amo.amo.amo.amo.amo.amo. bay
Fecha: 2008-06-10 11:25:16

zaira nicol escribió:
te quiero mucho banesa y tambien a zack los quiero son mi pareja faborita de la pelicula
Fecha: 2008-06-10 17:40:52

LUCIA Y PAULA escribió:
Fecha: 2008-07-18 16:12:40

fabiana escribió:
hola zac vanessa asshely moniquue lucas corbin esta muy chvere su pelicu pero en la vida real vanessa no me cae xk todo mundo esta enterrado que te iva a mandar unas fotos desnuda ademas xk ella iso k tu l cortes con asshely bye los quiero muxo byebyebyebyebyebyebyebyebyebyebyebyebyebyebye los tre sson guapos las tres tambien pero por ahi la gente dice que en algunas fotosvanessa tiene cara de hombre y no ve a ocultar que no estan xk io e visto las fotos de la playa
Fecha: 2008-06-11 12:28:08

isabel amaya escribió:
holachicos les escribo desde colombia quiero desirles que son los mejores cantantes que e escuchado en mi vida mis cansiones faboritas de ambas peliculas son de la1 breaking free y de la 2 all for one som las mejores bey
Fecha: 2008-06-11 16:32:34

Júlia escribió:
hay me lo passo genial con high school musical 2!!!!! el personaje que me gusta mas es... gabriela y de chico... troy soys los mejores un beso muy fuerte
Fecha: 2008-06-18 09:25:16

laurashley escribió:
hola m enkanta hsm 1-2 ashley tkm eres la mejor deseo ver ya la 3 weno m oi bsssss **ashtishare**
Fecha: 2008-07-11 05:44:23

Lara escribió:
a mi me encantaria q pongan juegos tipo para bailar o cantar o poder competir con otros chicos q tambien jueguen
Fecha: 2008-06-18 18:03:34

geraldine roa amaya escribió:
Fecha: 2008-06-19 08:24:57

daniela escribió:
troy sigue asi eres el mejor guapo un besazo muy fuerte te quiero chaito troy
Fecha: 2008-07-17 08:32:17

gabriela escribió:
troy y gabriela asen bonita pareja y me se todas las cansiones
Fecha: 2008-06-26 15:16:17

daniela ramirez escribió:
hola me gusta mucho su programa y me gustaria conocerlos mejor
Fecha: 2008-06-26 15:40:57

Carolina escribió:
Me encanta high school musical,y quien tenga algo en contra que vaya a donde viven los protagonistas y que se lo diga a la cara a ver si se atreve
Fecha: 2008-06-20 08:28:35

lourdes rodas escribió:
hola tengo 8 años mi exito es troi y grabiela me gusta como cantan en la 1y en la 2 llo beo todos los dias y me gusta mucho bueno chau suerte
Fecha: 2008-06-20 14:55:22

mili escribió:
hola tengo 8 años y me gusta mucho high school musical los cisiera ber bueno chaaaaaaaaaaaauuuuuuuuuuuuuuu suerte
Fecha: 2008-06-20 15:04:02

lucia escribió:
hola como andan los quiero mucho besitos muaaaaaaaaaaaaa
Fecha: 2008-06-20 17:19:37

laura c. escribió:
Fecha: 2008-06-20 17:36:21

daniela escribió:
troy sigue asi eres el mejor guapo un besazo muy fuerte te quiero chaito troy
Fecha: 2008-07-17 08:32:46

Constanza escribió:
Fecha: 2008-06-21 10:32:42

belen escribió:
ola todos lo de high school musical soi de alicante sois todos muy guapo el ke mas zac tengo 11 años mi msn
Fecha: 2008-06-27 08:38:17

belen escribió:
ola todos lo de high school musical soi de alicante sois todos muy guapo el ke mas zac tengo 11 años mi msn
Fecha: 2008-06-27 08:38:21

Diana. escribió:
Fecha: 2008-06-21 12:16:46

sarikika escribió:
osea m super encanta HIGH SCHOOL MUSICAL mi personaje favorit s SHARPAY EVANS Y TROY BOLTON desde la alberca murcia bien por mi!!!!!!!!
Fecha: 2008-06-27 09:01:23

Ebelin escribió:
Fecha: 2008-06-22 15:21:53

priscila escribió:
yo creo que es genial y que toda la gente podra jugar ya que a todos nos gusta high school musical 2 es fabuloso
Fecha: 2008-06-27 12:48:35

sara escribió:
esto no es de troy ...... pero lo tengo que contar: quiero a un xico de mi clase que se llama alexandre(x)es mui guapo i el no se si me quiere si algien que lea mi correo le pasa lo mismo que a mi le aconsego que aunque se burle que se lo digaa a ese xico que quiere porque a mi me funciono.Porque resulta que aora somon novios!!!!!!!!!!!!!!!
Fecha: 2008-06-23 07:30:01

stefania escribió:
Hola Sara i Pauli yo os conozco muy bien a las dos poerque sois mis mejores amigas bueno en primera posicion de amigas tengo 6
Fecha: 2008-06-23 07:44:40

paola escribió:
ola me llamo paola y amo a zac el ke se ase pasar por troy yo tengo 10 años bye
Fecha: 2008-06-27 15:12:13

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:13:47

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:13:47

diego escribió:
vanewssa eres unica bye
Fecha: 2008-06-28 17:46:07

Fecha: 2008-06-28 19:06:14

Pamela escribió:
soy la fan numero uno de high school musical estoy anciosa de ver la tres y sigan adelante lincees
Fecha: 2008-06-28 22:00:09

paulina escribió:
buenO yO opinO ke high school musical es muy paadreee porke llama muuuchO la atenciOn pOrke Osea kanta baailaaa y ps ai lOs niñOs aprenden nu nuebO baile y mas yo opino ke tambien deben de poner juegos ke aike kantar osea ke pongan a sharpay o gabriela no c y ke los niños kon laa teklas agan pasos kon los persOnajes.aaaaaaa y pOr siertO shaaaaaaarpaaayyyyy sOy fanatika a ty yo fui tu persOnaje de la obra ke isimos de mi kOlegio buenO baaauuuuu nu besO :) *
Fecha: 2008-06-29 01:49:51

clara escribió:
me encanta high school musical tengo todas las pelis y son supermegaguais sois unos actores muy buenos me encantaria conoceros a todos
Fecha: 2008-06-30 11:03:31

jenny escribió:
La película high school musical 2 fue muy divertida pero en la parte en la k gabriela se fue llore me dio mucha pena. Sois unos actores buenísimos ojalá hagais otra película pero sin sharpay que es una cursi.Chaitooooooooooooooooooo!
Fecha: 2008-06-30 16:34:35

Fecha: 2008-06-30 19:34:41

fabiolaa escribió:
eit ke onda zac,asley,venea,moni y lucas son de los mejor siguan asii son mis favoritos ssldss
Fecha: 2008-07-01 17:56:23

nuria escribió:
a mi me gusta mucho high school musical porque me gusta como cantan i sobre todo troy i gabriela son los mejores pero mas troy porque es guapisimo un beso para troy chao a todos que sepais que cantais i bailais muy bien adios otra vez i que sepais que me gustaria conoceros i sobre todo a troy un beso chao
Fecha: 2008-07-17 13:56:05

nuria escribió:
a mi me gusta mucho high school musical porque me gusta como cantan i sobre todo troy i gabriela son los mejores pero mas troy porque es guapisimo un beso para troy chao a todos que sepais que cantais i bailais muy bien adios otra vez i que sepais que me gustaria conoceros i sobre todo a troy un beso chao
Fecha: 2008-07-17 13:56:05

susana escribió:
he visto la peli y me a encantado a corvin estas buenisimo
Fecha: 2008-07-02 09:03:30

nuria escribió:
a mi me gusta mucho high school musical porque me gusta como cantan i sobre todo troy i gabriela son los mejores pero mas troy porque es guapisimo un beso para troy chao a todos que sepais que cantais i bailais muy bien adios otra vez i que sepais que me gustaria conoceros i sobre todo a troy un beso chao
Fecha: 2008-07-17 13:56:05

nuria escribió:
a mi me gusta mucho high school musical porque me gusta como cantan i sobre todo troy i gabriela son los mejores pero mas troy porque es guapisimo un beso para troy chao a todos que sepais que cantais i bailais muy bien adios otra vez i que sepais que me gustaria conoceros i sobre todo a troy un beso chao
Fecha: 2008-07-17 13:56:03

mireli escribió:
yo pienso que high school musical 2 estubo mejor que la 1 por que ai troy no se hace novio de sharpay, pero yo se que la 3 estara mucho mejor. eso es todo adioooooooooos!
Fecha: 2008-07-02 16:34:30

nuria escribió:
a mi me gusta mucho high school musical porque me gusta como cantan i sobre todo troy i gabrielason los mejores pero mas troy porque es guapisimo un beso para troy chao a todos que sepais que cantais i bailais muy bien adios otra vez i que sepais que me gustaria conoceros i sobre todo a troy un beso chao
Fecha: 2008-07-17 13:53:18

nuria escribió:
a mi me gusta mucho high school musical porque me gusta como cantan i sobre todo troy i gabrielason los mejores pero mas troy porque es guapisimo un beso para troy chao a todos que sepais que cantais i bailais muy bien adios otra vez i que sepais que me gustaria conoceros i sobre todo a troy un beso chao
Fecha: 2008-07-17 13:53:15

nayara escribió:
HOLA!!!!!!!!! Me llamo nayara y me gusta mucho high school musical 2 . Troy eres muy guapo y tu vanessa más quisiera ser yo como tu,queria que supieran que el día 6 de Diciembre por si me quieres hacer alguien un comentario en esta pagina . BESITOS NAYARA
Fecha: 2008-07-03 07:29:25

alcira escribió:
hola zac qui siera que fueras mi tio vannesa mi tia high scool musical los amo los adoro sui su fan numero uno
Fecha: 2008-07-03 20:24:04

LUCIANA escribió:
Fecha: 2008-07-03 21:17:50

nuria escribió:
a mi me gusta mucho high school musical porque me gusta como cantan i sobre todo troy i gabriela son los mejores pero mas troy porque es guapisimo un beso para troy chao a todos que sepais que cantais i bailais muy bien adios otra vez i que sepais que me gustaria conoceros i sobre todo a troy un beso chao
Fecha: 2008-07-17 13:56:06

maria escribió:
todos lo haces bien pero grabiela es la mejor
Fecha: 2008-07-17 13:59:50

alba escribió:
es muy guapa ashley tisdale y soy nu fan nº1
Fecha: 2008-07-17 14:22:10

alba escribió:
es muy guapa ashley tisdale y soy nu fan nº1
Fecha: 2008-07-17 14:22:18

alba escribió:
es muy guapa ashley tisdale y soy nu fan nº1
Fecha: 2008-07-17 14:22:23

alba escribió:
es muy guapa ashley tisdale y soy nu fan nº1
Fecha: 2008-07-17 14:22:24

alba escribió:
es muy guapa ashley tisdale y soy nu fan nº1
Fecha: 2008-07-17 14:22:24

alba escribió:
es muy guapa ashley tisdale y soy nu fan nº1
Fecha: 2008-07-17 14:22:24

alba escribió:
es muy guapa ashley tisdale y soy nu fan nº1
Fecha: 2008-07-17 14:23:06

alba escribió:
es muy guapa ashley tisdale y soy nu fan nº1
Fecha: 2008-07-17 14:23:07

alba escribió:
es muy guapa ashley tisdale y soy nu fan nº1
Fecha: 2008-07-17 14:23:07

alba escribió:
es muy guapa ashley tisdale y soy nu fan nº1
Fecha: 2008-07-17 14:23:08

alba escribió:
es muy guapa ashley tisdale y soy nu fan nº1
Fecha: 2008-07-17 14:23:08

laura escribió:
esta peli es genial
Fecha: 2008-07-17 16:03:50

jesus escribió:
creo que en disneychanel deverian poner pokemon
Fecha: 2008-07-18 10:16:15

fantaa2 escribió:
soys los mejoresss os quiero muchooo D:
Fecha: 2008-07-18 11:46:56

catalina escribió:
se viene las de hsm 3 y la verdad es que me encanta
Fecha: 2008-07-18 14:55:02

Maria escribió:
Olaaa,,Buueno yo Qeeria informaciion sobre HSM3 Peero no he encontrado nada...:( Buueno me tenGoo qee ir ,,Peero me encanta HSM,, ADIIOS!(L)
Fecha: 2008-07-18 15:01:52

sabrina escribió:
yo creo que este juego es el mejor que an inventado en todo el mundo
Fecha: 2008-07-04 09:41:48

pamela elizabeth escribió:
yo pienso que deberian de poner juegos de bailes para que la persona se divierta mucho y acumule muchos puntos a y soy fan de las canciones de high school musical
Fecha: 2008-07-04 14:21:44

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:13:30

javiera escribió:
hola soy javiera de chile a mi me gusto mucho high school musical la 1y2 pero no deberian ya poner a sharpay como que le gusta el troy porque cuando estaba terminando antes de la ultima cancion ella se veia con el negrito de sic bueno eso no mas bai firma la javi
Fecha: 2008-07-04 14:58:14

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:12:05

sharon escribió:
Fecha: 2008-07-04 20:10:38

selene escribió:
zac sos re lindo para mi vos tendrias que ser el novio de vanessa que es la mejor y mi idola !!!!!!!!!! te quiero mucho un beso ... chau
Fecha: 2008-07-04 23:54:53

silvi escribió:
Te amo Zac.Vannesa cuando sea grande sere como tu.Ashley realmente te admiro.Lucas me caes bien.corbin a mi hermana le gustas.Monique te admiro muchicicicicimo.
Fecha: 2008-07-05 13:54:30

Sandra escribió:
Vanessa wapa te kiero mucho.eres la mas guapa del mundo!!!!!!!!!!!!!
Fecha: 2008-07-05 14:11:56

Javiera Ignacia Miskulini Alarcò`n escribió:
Yo Javiera le quiero preguntar a Gabriella como estar tan linda en la pelicula y a Troy que como esta tar tan guapo xao
Fecha: 2008-07-05 14:51:38

silvi escribió:
Te amo Zac.Vannesa cuando sea grande sere como tu.Ashley realmente te admiro.Lucas me caes bien.corbin a mi hermana le gustas.Monique te admiro muchicicicicimo.
Fecha: 2008-07-05 15:20:18

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:13:35

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:13:45

katherin i escribió:
me gusta todo de ustedes
Fecha: 2008-07-13 19:14:26

ihaxss escribió:
me endcanta zac (poqqemones)
Fecha: 2008-07-13 20:50:34

Fecha: 2008-07-06 14:27:20

andrea escribió:
ola a todas-os ami me encanta high school musical pero tienen que poner mas juegos tienen que poner los juegos mas chulos de high school musical. bueno un beso para todos-as mua os kiero mucho gabriela,troy,os kiero muchisimo adios os kiero
Fecha: 2008-07-14 08:42:28

veronica escribió:
zark estas como un queso y me gustaria que me dieras tu correo electronicao tio bueno cada bez que te beo empiezo a babear te quiero guapisimoooooooooooooooooooooooo
Fecha: 2008-07-14 10:38:00

karol escribió:
hola me llamo karol y soy fanaticas de high scool musical 2 y desiaria ir a berlos y y te quiero dar mi mesenger xauuuu los quiero de karol
Fecha: 2008-07-06 21:58:22

lidia escribió:
hola soi lidia high school musical son mis mejores jans ojala conocerlos de cara a cara y quiero que siesto llegan a ellos que tengan mi msn
Fecha: 2008-07-07 07:41:24

maria luz escribió:
hola chico como estan me llamo maria luz me encanta su programa esta re copdo y ahora estoy eperando la peli3 de ustedes me encanta como vanesa actua pero ella noes asi en la pelicula como es haora
Fecha: 2008-07-15 12:54:55

mishel escribió:
hola high school musical les quiero decir que vuestra película es estupenda y que me mandes muchos imágenes a mi correo es adios gabriela y zac :) :) :)
Fecha: 2008-07-07 10:45:43

jayleene escribió:
hola soy grabiela estas muy guapo troy amor esres mio solo
Fecha: 2008-07-07 12:21:50

ahilin escribió:
en este momento estoy viendo la peli
Fecha: 2008-07-14 13:54:46

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:13:37

clara escribió:
hola me llamo clara me encanta high school una fanatica a vuestras pelis y todos son mu guapos y guapas sobretodo troy y abriela. besos. y love you. att clara
Fecha: 2008-07-14 15:54:14

mireia escribió:
me encanta mucho la serie soy una fan me gustaria ser como Vanesa
Fecha: 2008-07-08 04:17:11

Soledad escribió:
me gusta me gusta mucho la pelicula de high school musical
Fecha: 2008-07-08 07:49:51

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:13:39

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:13:40

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:13:44

carolna escribió:
ola me llamo caro y me gusta high scholl musica...mi msn es agrgadmee
Fecha: 2008-07-15 06:02:15

camila aguirre escribió:
chicos son muy lindas las pelis que isiero ya no veo el momento que salgan la 3 la 4 la 5 la 6 la 7 la 8 la 9 la 10 bueno todas
Fecha: 2008-07-08 13:44:41

natalia escribió:
te quiero zac me puedes agregar a tu messenger porfa un beso estas to bueno guapo.
Fecha: 2008-07-15 09:44:11

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:13:48

rebeca escribió:
hsm2 es lo mas bakan de la pantalla cika y gande se los rekomiendo chaolin de tu amiga rebeka
Fecha: 2008-07-09 12:42:39

francisco escribió:
Me encanta hsm pero mas Gabriella
Fecha: 2008-07-09 13:16:09

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:13:53

manuel escribió:
estan muy lindas las de hsm
Fecha: 2008-07-09 13:43:56

laah makiiiwii !!! escribió:
bueno primero q todo me encanta hsm especial la 2 mmm bueno en q mas me gusta de los hombres es troi y la deberia ser la polola de troi deberia ser la charpei osea to el ratoon x q la grabiela es mas rogadricta osea no se lo merese............bueno me despido con carino y amor xaiitoo.
Fecha: 2008-07-18 19:13:54

yumara escribió:
me encanta high school musical(L)
Fecha: 2008-07-19 08:47:24

la murciana escribió:
a mi me encanta high school musical y por eso creo para acceder a su pagina os voy adar una supermega noticia los protas de high school musical vienen a españa el 2 de octubre a madrid y pasaran a lli un dia entero .Tambien tened cuidado con lo que le decis a zac efron porque sabe un poco de español
Fecha: 2008-08-06 06:55:17

patricia escribió:
zac efron estas buenisimo y sois los mejores un beso
Fecha: 2008-07-19 10:00:49

Tamara escribió:
Fecha: 2008-08-07 06:47:14

MARIA escribió:
eres guapo troy
Fecha: 2008-07-19 11:02:45

ana escribió:
quuiero conseguir el msg de zac y ashley
Fecha: 2008-08-06 06:17:45

shakyra escribió:
mando saludos a todo el elenco son:troy;gabriela;sharpay;ryan;chard y taylor
Fecha: 2008-07-19 14:06:43

ari escribió:
hola zac vanessa ashley corbin lucas i michela tengo los posters de hsm1 2 i 3 el de la 3 mola besoos te amo zac
Fecha: 2008-07-19 14:36:09

andrea escribió:
Fecha: 2008-08-06 09:09:21

julia escribió:
Fecha: 2008-07-20 02:57:35

miriam escribió:
el mejor chico de guapo es el zack Efron por k es muy guapo y la chica mas guapa Graviela soy los mejores high school musical un beso poneos mi Email porfa para ablar con bosotros
Fecha: 2008-07-20 04:12:35

carlitos fonseca escribió:
a mi me encanta como bailan y cantan. la mejor es ashley tisdale es la mas bonita
Fecha: 2008-07-20 10:49:39

laura escribió:
gabriela es muy guapa y troy ++++ gabriela+troy
Fecha: 2008-08-06 10:33:36

paula escribió:
me encanyta high school musical lo haceis mui bien me gustaria conoceros en persona gabriella eres mui guapa y sharpei tambien es decir todos sois guapos
Fecha: 2008-07-20 10:53:09

elena escribió:
high school musical me gusto desde el momento en que la vi y zac es muy guapo. megustaria que vinieseis a gandia
Fecha: 2008-07-21 03:52:10

susana -@susa escribió:
me encantan vuestras pelis y tambe
Fecha: 2008-07-21 08:51:12

susana -@susa escribió:
me encantan vuestras pelis, tambien quiero que vengais a españa hacer un concierto en salamaca porfi, un saludo de vuestra mayor fan.
Fecha: 2008-07-21 08:55:28

andrea escribió:
soys los megores sobre todo troy bolton y gabriela montez os quiero musoo y estoy nerviosa por ver haig school musical 3 tiene que ser la bonba grabriela eres la mas wappa de la pelicula.Soy tu mayor fan¡¡¡¡¡¡¡¡¡¡¡¡¡
Fecha: 2008-08-07 10:19:55

susana -@susa escribió:
me encantan vuestras pelis, tambien quiero que vengais a españa hacer un concierto en salamaca porfi, un saludo de vuestra mayor fan.
Fecha: 2008-07-21 08:56:06

paula escribió:
soy paula sin ofender a mi la chica mas guapa es sharpei y el chico mas guapo es corvin pero gabriela es muy buena atriz y zac efron tambiem es guapicimo y es un actor muy bueno teilor es guapa... perono tanto como sharpey corbin eres guapicimo.
Fecha: 2008-08-05 10:48:44

juan camilo torres rios escribió:
me gusta mucho high school musical y mi cancion favorita es what time is it?
Fecha: 2008-07-21 10:59:08

juan camilo torres rios escribió:
vanessa eres guapisima
Fecha: 2008-07-21 11:00:47

juan camilo torres rios escribió:
me encanto las tres peliculas las canciones son geniales
Fecha: 2008-07-21 11:01:47

juan camilo torres rios escribió:
me encanto las tres peliculas las canciones son geniales espero ke hagan algun cocierto en españa en granada
Fecha: 2008-07-21 11:03:49

idayra escribió:
Fecha: 2008-08-07 10:55:24

alejandro escribió:
disculpa mi primas son fanatica de bos no podes mandarde un saludo para gabi y nicol y jimena nos bemos chau ub beso
Fecha: 2008-07-21 12:09:20

jessica escribió:
zac eres guapisimo kiero tu msn x favor
Fecha: 2008-07-21 14:26:35

jennifer fabulous forever where ashley tisdale escribió:
osea helloo soy fan #1 DE HIGH SCHOOL MUSICAL a mi me encanta el papel de ashley tisdale como sharpay evans,zac efron como troy y lucas gabreel como ryan xq los dos hacen papel de gemelos y ryan la apoya en todo pero en la 2 parte no tanto pero la quiere como es y troy es un chico muy muy guapo y sabe lo que hace y siente pero despues de todo en la vida real todos son amigos.. y eso es lo mejor ke puede a ver en la vida los buenos amigos que estan en las buenas y en las malas despues de todo ashley y vanessa son super amigas salen de compras y todo eso y en la peli sharpay no es amiga de gabriela pero en la vida real lo son pues venga que viva hsm1! hsm2! PUES MIRA QUE YA ESTA LA 3 parte de hsm y se ve que esta muy bonita asi que no se la pierdan en cine el 24 de octubre para los fans como yo x dios los quiero especial a zac ashley y lucas pero mas a zac y ashley besos cuidense .......tkm.............zac ...........tkm...........ashley y tk......lucas + zac y ashley chao...............besos..
Fecha: 2008-07-21 14:31:48

crystal escribió:
vanesa tueres mimallor almiradora y unica di ti y de high scool musical
Fecha: 2008-08-08 07:53:00

maria escribió:
hos quiero a todos muchissimo,me dais vuestro msnplis:) wapissimos
Fecha: 2008-07-22 04:21:25

laura escribió:
high school es una pasada zac eres wapisimo y cntas super bn jeje dame tu msn xfxfx wapo bsbs
Fecha: 2008-07-22 10:22:51

JULIETA escribió:
Fecha: 2008-07-22 11:34:18

Sara alvarez mira escribió:
Fecha: 2008-08-08 06:40:19

gaby de monterrey nuevo leon mex. escribió:
mi hija tiene 7 años y ama ha sac efron solo quyiero una foto de el
Fecha: 2008-08-05 17:39:14

minerva escribió:
ola soy mine tengo 14 años me gusta muxo high school musical tbm quiero decirle a zac efron q sta wenisimooooooo y q si x favor me pudiese dar su msn
Fecha: 2008-07-22 11:53:40

wiljoselis escribió:
bueno los felicito espero que high school musical 3 sea un exito total y sean muy bendecidos son lo maximo¡! xd¡!
Fecha: 2008-07-22 18:02:42

camila escribió:
A mi me encantan los personajes. Son divertidos,graciosos i todos/a guapos/a.Jo soy de argentina bine a españa i lo que mas me gusto es troy,gabriela,sharpey,lucas...
Fecha: 2008-08-08 07:11:21

cristina escribió:
hola chicos somos cris y rafa nos encanta hight school musical 2 y todo el canal disney
Fecha: 2008-08-10 15:22:42

david yeray escribió:
son los mejores del mundo cantando los mejores de los mejores
Fecha: 2008-08-10 15:38:38

ariana gissela escribió:
me gusta high school musical soy fanatica a ese programa y me gusta como acytuan gabriela y troy besos para todos los quiero mucho
Fecha: 2008-09-01 17:08:24

martina escribió:
me encanta high school musical soy una fanatica quisiera ganar los juegos porque soy asi de amor a disney
Fecha: 2008-08-20 18:59:13

marina escribió:
ma gusta troy y gabriela me gusta la pelicula de high school musical 2 me gusta el final de la pelicula cuando se encuentra toy y gabriela
Fecha: 2008-08-11 03:13:45

VALENTINA escribió:
hola como estas
Fecha: 2008-08-11 04:50:07

ICHI escribió:
Fecha: 2008-08-11 04:54:38

monica bolaños escribió:
ke wai soiss xd!! me encantaria conoceros ...zaz eress el mejorrr ke wapo eres!! muxos besotess xicoss
Fecha: 2008-09-05 08:13:43

eduardo escribió:
te amo karla luna
Fecha: 2008-08-22 22:05:27

sofia escribió:
a mi lo que mas me gusta es las haventuras de zak y cody es lo mejor!!!
Fecha: 2008-08-11 05:32:47

ANGELA escribió:
hola soy angela y tengo 11 años y espero con impaciencia la peli de HMS3 y me gustan todos los personajes pero en especial zac y vane xau
Fecha: 2008-07-23 06:13:25

marta escribió:
troy bolton esta como un keso
Fecha: 2008-07-23 08:36:45

maribel escribió:
es genial
Fecha: 2008-08-10 15:11:12

carolina escribió:
k guay estan tus páginas muy chulas kiero k hagais muchas mas. ok ???
Fecha: 2008-08-06 03:34:47

ruby estefani escribió:
mi comentario es que su high school 3 sea super calidad, troy bolton estas papasito muaaaaaaaaa besos me encanta high school
Fecha: 2008-07-23 14:45:54

fetima escribió:
troy estas buenisimo a ber cuando benis a cantabria otra vez me guataria ser mallor y escharte un buen polbo
Fecha: 2008-08-06 04:53:13

sharon fonseca escribió:
a mi me gustaria ser amiga de vanessa hudiens
Fecha: 2008-07-23 21:59:07

marga escribió:
Troy Bolton esta buenisimoo mencanta high school musical
Fecha: 2008-07-24 06:09:44

maria camila quintero escribió:
bueno hola a todos queria decir que hig school es lo maximo yo no cambiaria mas de pelicula porque esta esta mejor que todas yo tengo una pregunta porque ellos no hacen un concierto aquie en barranquilla para yo poder ir porfa porque yo no puedo ir ni a bogota ni a medellin no puedo yo soy de barranquilla
Fecha: 2008-07-24 07:45:44

ashley marian reyes infantes escribió:
hola amigos ay una de high school musical k se llama ashley ygual k yo los kiero ver en vida real ya son tan bonito k los amo kiero k me den su msn para ablar con ustede ok esta claro gane en un corcuso cantando gane un poloche de high school musical 2 y un globo de claro los kiero mucho a santa le voy a pedir juguetes de high school musical los kiero muak
Fecha: 2008-07-24 12:38:42

candela escribió:
Hola chicos la peli me inpresiono zac te amo no tengo mas nada que desir es la mejor peli que e visto en toda mi vida chauuuuuuuuuuuuu
Fecha: 2008-08-29 10:52:29

diego escribió:
a mi lo que me gusta de la pelicula high school musical 2 cuando troy canta con gabriela
Fecha: 2008-08-07 14:15:47

thalia meseguer bañuls escribió:
por que no echan high schoo miusical 2 en antena 3
Fecha: 2008-08-08 08:06:23

angelly morales escribió:
ami megusta troy y sharpey creo que hacem una linda pareja
Fecha: 2008-08-08 09:15:41

Paula escribió:
Hola me llamo Paula. Soy de Tenerife y vuestra fan nº1. Me preguntaba si ibais a dar un concierto aquí en Tenerife alguna vez, si fuera asi estaría en 1ªfila. un saludito paulita.
Fecha: 2008-07-25 07:25:50

albertsh escribió:
yo creo que high school musical es un grupo de lo mas y tengo que añadir que SHARPAY esta muy buena, an GABRIELA tiene que dejar de ser tan buena actuando y tener mas veneno.TROY no haces nada bien el papel de enamorado de GABRIELLA.
Fecha: 2008-08-07 15:39:01

meliannys escribió:
hello hsm enverdad son unas star osea todo cool los admiro de mas son un mundo para mi , quiero ser como ustedes bueno espero q le alla gustado mi comentario .Espero algun día verlos y estar con ustedes gracias por todo chao besitos bye!!!!!
Fecha: 2008-07-25 15:50:24

estefania escribió:
hola chicos estoy impaciente por ver high school musical 3 les mando saludos a todos bayyyyy! los quieroooo mucho y espero que vengan para venezuela(margarita) te amo troy*******************los amo a todos!!!!!!!!!!!1
Fecha: 2008-07-25 21:11:45

eva escribió:
hola chicos esto deseando veros de verdad high school mosical 3 es el mejor
Fecha: 2008-07-26 08:58:06

Fecha: 2008-07-26 09:32:32

lokita escribió:
zac efron esta mazo buena vane que suerte tienes
Fecha: 2008-07-26 10:44:07

monica hernandez lugo escribió:
espero que resiban la carta y que me escriban
Fecha: 2008-08-08 02:33:50

Laura Morales Nuez escribió:
Adrienne Bailon es mejor que estes con las Cheetah Girls.Te adoro soy tu fan numero 1 pero tambien soy fan de Vanessa y empesaron con ella la pelicula y deben terminar con ella Besos a todos Laura.
Fecha: 2008-07-26 14:08:44

camila escribió:
s super bueno
Fecha: 2008-07-26 15:46:38

Aroa escribió:
zack eres muy muy muy muy muy muy muy muy guapo
Fecha: 2008-07-26 15:47:18

marisa escribió:
hola chocos como andan les quierodecir que los quiero mucho amo a high school musical bueno me voy llendo besos adiosssssss
Fecha: 2008-08-15 14:04:23

nasly escribió:
bua no ai palabras esta pagina mola muxo
Fecha: 2008-08-12 14:52:53

sandra escribió:
me encantan los nick jones i estoy esperando a que saquen la nueva pel.licula
Fecha: 2008-08-12 14:58:46

juli trossero escribió:
hoola soy juli trossero y vale`´ agos trossero somos primas nos gusta high school musical besos
Fecha: 2008-07-26 21:18:29

mauricio escribió:
hola soy mauricio yo quiero que salga ya en dvd o en disney chanell la pelicula de higt school musical 3 fin de curso me muro por verla
Fecha: 2008-08-08 03:11:41

Guadalupita escribió:
me gusta mucho high school musical estoy esperando con mucha ilu a ke llegue la 3º
Fecha: 2008-08-08 03:51:55

elena escribió:
soy una fan de hich school musical y me encantan las canciones. BUENO ADIOS UN BESAZO MUY GORDO
Fecha: 2008-07-27 06:29:44

andrea escribió:
troy es el mas guapo de la peli te quiero un monton
Fecha: 2008-07-27 06:33:08

katherine escribió:
hola soy katherine quiero decir que troy y gabriela hacen una bonita pareja y quiero que me agregeis vuestro msn bueno me despido un besazo muy grande para todeos los de high school musical
Fecha: 2008-07-27 08:16:48

nicol escribió:
yo me he enamoraado de zac efron aunque tenga 21 años pero yo tengo 20 veo serie y peliculas e zac efron desde años y me han gustado mucho mi sueño seria que el me diera un beso y me firmara una autografo
Fecha: 2008-07-27 10:10:01

DuLii escribió:
WaUu Zac Es monisisisimo Es super liindo jeje..y vanessa es guapay se nota que es buena chica..Les escribo desde gran canaria..y aver si se estrena HIGH SCHOOL MUSICAL 3 FIN DE que me encanta sus peliculas...Besos Adios
Fecha: 2008-08-08 17:04:34

maria. escribió:
hola soy maria y soy vuestra fan nnumero se lo que habria pasado si no hubiera visto vuestra peli. me encantais.
Fecha: 2008-08-08 06:00:16

Florencia escribió:
hoola chicos de high chool musical mi nombre es florenciamacua soy de cipolletti mi email es soy su fan numero 1 yo los conosco por que yo fui a su concierto en buenos aires no los pude saludar por que mi mama pensaba que no avia lugar adonde ustedes ponen actografos poreso cantan re lindo como me gustaria tener esa vos estuvieron ecselente e nel concierto pero algunos fueron a ver patito feo pero yo fui a ver los a ustedes por que antes yo no savia que estaba esa no vela pero ahora si chicos me tengo que ir chau besos cuidensen
Fecha: 2008-08-12 17:10:33

daniel escribió:
ola soi daniel me encanta HighSchool Musical sobretodo sus pelis vuenoadios
Fecha: 2008-08-21 16:54:43

sandra escribió:
soy sandra y soy tu mayor fan y keria tu mns
Fecha: 2008-08-13 04:46:47

angela escribió:
ola esta pagia no la e vito en m vida i ahora q la veo qreo q soy famosa adios un beso para todos los famosos
Fecha: 2008-08-13 04:51:49

jose escribió:
hola esta chulo y me ncanta disnei astaluego
Fecha: 2008-08-13 04:58:55

cristina escribió:
me encanta high school musical estoy esperando a octubre para ver high school musical 3 fin de curso¡¡¡¡¡¡¡¡¡¡¡
Fecha: 2008-08-13 06:25:26

marina escribió:
hola,me llamo Marina ,tengo 9 años y tengo 1 hermana que se llama Cristina y tiene 13 años.Nosotras siempre vemos dysneychannel y vemos raven,hanna montana,etc.. bueno hos tengo que dejar ,adios.
Fecha: 2008-08-13 07:26:04

PATRICIA escribió:
Fecha: 2008-08-13 07:44:10

andrea escribió:
sois la caña de disney channel me gustan vuestras peliculas y las veo cada dia por lo menos 5 veces al dia un beso y un abrazo soy vuestra fans 1º andrea
Fecha: 2008-08-13 08:28:55

ANA escribió:
tengo ganas de k estrenen high school musical 3
Fecha: 2008-08-13 08:32:58

ambar escribió:
high school musical es la mejor peli que vi amo a zac efron es el mas lindo del mundo
Fecha: 2008-08-08 20:35:06

valeria escribió:
aaaaaaa amo a troy y odio a la gabriela se lo esta rovando es solo mio i despues se lo voy a regalar a la charpay y seremos amigas para siempre vesos sharpay
Fecha: 2008-08-08 20:42:51

eva escribió:
me encanta high school musical e visto millones de veces sus pelis i todas me an gustado muchoo!!!!
Fecha: 2008-08-20 13:56:52

sara escribió:
zac es el mejor vanesa es la mas wapa aunk sarpey en la segunda peli sale mui wapa
Fecha: 2008-07-28 05:36:35

FAN DE HSM escribió:
Me encanta hsm pero no deverian tardar tanto en poner las pelis de disney chanel, ¿no creeis???
Fecha: 2008-08-13 10:27:38

valeria escribió:
aaaaaaa amo a troy y odio a la gabriela se lo esta rovando es solo mio i despues se lo voy a regalar a la charpay y seremos amigas para siempre vesos sharpay
Fecha: 2008-08-08 20:42:59

DULCE escribió:
Fecha: 2008-08-08 21:08:36

thalia escribió:
la pelicula estuvo super
Fecha: 2008-08-28 13:48:47

mayte escribió:
hola yo pienso que deven de poner juegos de cansiones para que los niños escopjan su cansion favorita y la canten
Fecha: 2008-09-01 11:29:33

nur escribió:
mellamo nur tengo 9 años y pienso de ellos ke les kiro visitar chaoooooooooooooooooo
Fecha: 2008-08-09 03:53:15

noelia escribió:
ola me encanta disney channel y mi pelicula prerida es la de high school musical 3 y mis personajes preferidos son gabriela y troy
Fecha: 2008-08-14 05:31:02

maria escribió:
hsm me gusta muxooo epero k sigan poniendo mas y mas capitulos
Fecha: 2008-08-14 08:02:24

sofia escribió:
hola yo soy sofia me encanta el troy y quisiera que me diera su fotolog ya eso xau............................
Fecha: 2008-07-28 21:04:06

daniela escribió:
Fecha: 2008-07-28 21:07:38

phany escribió:
yo pienso que deberia de aber juegos de cantar en donde los niños eligan su cansion faborita y le pongan el sonido de la cancion que eligieron y les den puntos si la cantan bien y esos puntos se cambien por premios
Fecha: 2008-07-29 04:51:50

Tamara escribió:
me gusta mucho hotel dulce hotel,high school musical... Espero poder ver Camp Rock ¡Viva el mejor canal!1 beso para tod@s los que estais viendo esto y para Zac y Ashley.Adiiiioooooos.
Fecha: 2008-08-09 07:09:18

laura escribió:
hola!soy laura y soy fan del programa disney channel ,espero q disney channel no lo quiten del tdt y que si cabe l posibilidad q venga camp rck o high school musical ... a ESPAÑA ...jejeje soy fan de ellos y me encantaria ver un concierto de las bands musicls suyas mucho cariño ...LAURA.
Fecha: 2008-08-09 08:44:54

andrea escribió:
me escanta todas las peliculs de high scool musical ME ENCANTA
Fecha: 2008-08-09 11:21:38

andrea escribió:
estoy inpaciene por ver haig school musical 3 se que va a molar un monton sobre todo gabriela
Fecha: 2008-08-29 03:53:37

tatiana garrido escribió:
Hola yo soy nueva a qui y os quiero decir que soys geniales bueno os dejo porque voy a ver Raven que os lo paseis bien.
Fecha: 2008-08-29 04:03:34

tatiana garrido escribió:
Hola soys mejores porsupuesto Vanesa que os lo paseis bien
Fecha: 2008-08-29 04:05:36

dayana escribió:
ola soy dayana sabeis cual es mi programa faborito disneychanney troy y grabiela sois muy guapos os quiero moito asta luego besotes
Fecha: 2008-08-10 08:28:39

juan carlos escribió:
soy geniales cantais muy bien
Fecha: 2008-08-10 08:54:13

Maria Jose escribió:
hola me llamo Maria Jose soy fanatica de hannah montana y high school musical me encanta las canciones de ellos son bonitas me gusta disney channel es chevere
Fecha: 2008-07-30 10:16:48

antonela escribió:
hola me llamo antonela soy fanatica de high school musical 2 y de zac y codi gemelos en accion
Fecha: 2008-07-30 12:01:26

thalia escribió:
vanessa keria decirte ke eres lo maximo y ke soy tu fan number 1 te quiero mucho un besito
Fecha: 2008-07-30 12:25:33

vanesa escribió:
olaa que uay
Fecha: 2008-08-10 08:58:12

juan carlos escribió:
me gustaria ablar con tigo gabriela
Fecha: 2008-08-10 08:58:25

Ainoa escribió:
Hola, Soy tu fan numero 1, me gusta mucho High school musical, a veces lloro y todo, Vanessa hudgens: a veces sueño con ser tu,haceis muy buena pareja Zac y tú,te quiero mucho, un besito de Ainoa Zac efron: le gustas mucho a Vanessa y no tienes que hacer caso a Sharpay, en la série no te sabes enfadar, en la vida lo sé. Os quiero mucho a los dos, un besito a cada uno. Posdata: Me podrías conestar, porfavor?? Me haría mucha ilusión. Ahí tienes mi direción de correo electrónico.............
Fecha: 2008-07-30 14:14:24

franchesca maldonado escribió:
hola soi la menor franchi y desque la pelicula me volvi creisi yo lo amo a todo9s dios lo bendiga ilove bay
Fecha: 2008-07-30 14:41:30

GELSYS escribió:
Fecha: 2008-07-30 15:34:02

karen escribió:
zac soy karen xao
Fecha: 2008-07-30 17:46:21

mia escribió:
ola a todos os quiero
Fecha: 2008-08-29 13:17:08

mari escribió:
me encanta
Fecha: 2008-07-31 09:35:10

Fecha: 2008-07-31 10:06:07

samuel escribió:
soy buestro numero1
Fecha: 2008-08-23 05:23:46

maria escribió:
soy la fan de vanesa q trabaja como grabiela
Fecha: 2008-08-23 09:22:27

manuel escribió:
vanesa kattyens estas muy guapa y cuando en dysney channel days un pequeño avance y me gusta cuando tu y zac cantais yo incluso bailo en mi casa la cancion de high shool musical
Fecha: 2008-08-11 06:38:14

kristina escribió:
Fecha: 2008-08-11 09:15:33

miriam escribió:
m ncanta asli y m da igual como se scriba.m gusta xq 1 d las mejores series q a exo y q actua d buena s "hotel dulce hotel las aventuras d zack y cody"
Fecha: 2008-08-10 09:53:35

chami en la fama de sharpey escribió:
hola sharpey yo soy re fanatica de vos pero re fanatica de vos te re amo sharpey pero te amo
Fecha: 2008-08-10 11:01:40

Fecha: 2008-08-10 11:36:03

yo escribió:
la pelicula uno estuvo mas buena que la dos... saludos a todos...
Fecha: 2008-08-10 13:07:16

Gabriella escribió:
soy gabiella y os mando un gran beso a todos vosotros aora estoy ensayando mi nuevo disco y como es un secreto no os lo voy a decir muchas gracias admiradores por escribirme a mi wed xaoxao y baybay
Fecha: 2008-08-10 14:28:59

sara escribió:
zac efron es feo vanessa hudgens es poquito bonito joe jonas es mas bonita que zac efron y demi lovato es mas linda que vanessa hudgens y camp rock es mucho mejor que high school musical
Fecha: 2008-07-31 14:13:07

sarai escribió:
creo que deberian hacer la 4
Fecha: 2008-08-11 11:33:53

Nazareth escribió:
zac efron esta buenisiimo la pareja zanessa es total por cierto en mi ciudad motril mi peña andrea sanchez andrea esteban y yo nos encanta hsm 1 2 y queremos que halla 3 4 5 6 7 8 y9
Fecha: 2008-07-31 15:29:20

teddy aruquipa escribió:
me encanto la pelicula mis personajes favoritos son troy y gabriela y me encantan sus canciones
Fecha: 2008-08-11 12:07:14

laura escribió:
ami me encanta high scjool musical y sere una de las ganadoras de los packs :) ya lo vereis :D
Fecha: 2008-08-11 16:00:44

ana maria escribió:
yo tengo muchas ganas de ver la peli de hsm 3 y mi pasion el hsm y sharpay os quiero,ay ayi tanbien corbin(chad),muchos besos
Fecha: 2008-08-28 15:52:22

Noelia escribió:
Yo e visto high school musical mas de 1.000...Y los 2 personajes que me gustan mas son (EL TROY I SU NOVIA VANNESA)...Los eligo a ellos 2 por que me gusta mucho como cantan la cancion (High School Musical 2 - Everyday)...Quien la aiga visto piensara lo mismo que llo seguro...Los otros personajes ya no me gustan tanto por que no cantan siempre yo solo veo cantar a (TROY Y VANNESA)...i los veo por la calle les pido un autrogafo a cada 1...Por eso os quierom decir que high school musical es la mejor musica del mundo entero...Ai os recomiebdo ver (High School Musical 2 - Everyday)...Si alguien la a visto os doi mi mesenger para que me deis vuestra opinion vale mi msn va en minuscula lo que arora lo piongo en grande para que lo sepais bueno a qiie teneis mi msn (NOELIA_ESC@HOTMAIL.COM)...Quien quiera ablar de high school musical me puede llamar por msn...A por cierto no es que sea pesada pero os recomiendo ver un corto de cuando(TROY)gana el partido aqui lo teneis (High School Musical 3: Senior Year)..Cuando veais esto tanbien me llamais para dar buestra opinion vale os quiero hig school miusical...ADIOS...Pongo mi msn otra vez va tado en minuscula para que lo sepais (NOELIA_ESC@HOTMAIL.COM)Bueno me voi llamatma si ves estos 2 videos..CHAO ADIOS...
Fecha: 2008-08-21 06:23:11

CARMEN escribió:
Fecha: 2008-08-01 03:54:33

ana escribió:
hola me llamo ana y me encanta high school musical troy me encanta esta super bueno....y tengo su msn . ADIOS********
Fecha: 2008-08-01 04:42:30

victor alegandro de sanvi escribió:
unos amijos i llo estamos esperando a camp rock sera una pasada no os lo perdais en disney chanel,i dijo lo mismo en fin de curso 3 schull musical seran las mejores peliculas del mes
Fecha: 2008-09-07 07:55:18

aroha escribió:
Gabriela me gustaria conocerte soy fan tuya
Fecha: 2008-09-04 08:53:04

maria lara escribió:
¡hola! me gustaria conoceros a todos. todas las pelis de high school musical son lo mejor que hai y las canciones ni te digo
Fecha: 2008-08-12 02:33:05

alberto escribió:
troy y chad son los mejores soy buestro mayor fand espero q me escribais porfabor
Fecha: 2008-08-01 07:42:03

julia escribió:
quiero casarme con troy i love you
Fecha: 2008-08-01 11:39:39

lorena escribió:
estoy deseando ver la tercera parte sois maravillosos.
Fecha: 2008-08-10 06:34:54

marta escribió:
Zac Efron esta buenisimo y para my es el tio mas guapo del mundo. arriba esos ojazos, que son preciosos. Vanessa tu aprovecha ya que estas saliendo con el, solo por eso ya eres una privilegiada. aaayyyy si yo estuviera con el... en fin. dw wapixxiixxiimos todos os kiieroh muxooooooooooo 1000 besiitos xaiito
Fecha: 2008-08-29 18:09:18

LEIDY JOHANA escribió:
Fecha: 2008-08-15 21:31:24

ariadna escribió:
me encanta high school musical 2 pero añadiria una sola cosa mis canciiones si me gusta escribir canciones pero nunca se las he enseñado a nadie.Mis canciones estan en español. una cancion se titula amor: AY AMOR MI DULCE FLOR DE LA PASION POR TU AMOR DEL ALMA.Me encanta que me hables me encanta que ne llores me encanta que me digas lo sientooooooo amoooooor
Fecha: 2008-08-12 04:23:12

sohaila escribió:
ola quiero los msn de high school musical y kiero ke alguien me lo mande por el msn por favor el que tenga los msn de high school musical ke me lo mande y los ke mas me gustan de high school musical son todos!!!adios por favos lo mas inportante para mi es ke me envien los msn de high school musical gracias adios
Fecha: 2008-08-02 10:11:46

derek escribió:
soi wai i mui guapu tengo 16 añicos i me encanta hig por las chikas
Fecha: 2008-08-12 05:03:26

alba escribió:
esto es para todos de hit shool music -y es ke son mis idolos gabriela eres la mejor y troy te kiero muxo troy y soy de bnk tengo 12 y mi deseo es tener buestros msn viva hit shool music!!
Fecha: 2008-08-12 05:55:57

anna escribió:
bosotros creeis que puedo llegra aser cantante i actriz como bosotros?
Fecha: 2008-08-21 07:54:16

claudia escribió:
yo creo que zack efron esta buenisimo
Fecha: 2008-08-12 08:06:34

claudia escribió:
yo creo que zack efron esta buenisimo
Fecha: 2008-08-12 08:06:39

lussu escribió:
esta padrisimo
Fecha: 2008-08-21 08:51:50

miriam escribió:
Me encanta high school musical 3 es una pasada la mejor peli de todas y me encanta zac efron mi msn es Bss a todos os quiero
Fecha: 2008-08-12 08:37:13

Irati escribió:
Hola megustan vuestras canciones y de vosotr me gusta gabriela
Fecha: 2008-08-29 10:20:54

julia escribió:
nolo e jugado estara divertido
Fecha: 2008-08-28 17:52:17

lorena escribió:
me encanta high school musical 2,gabriela es muy guapa me gustaria ser ella y de troy me gustaria ser su novia le tengo de fondo de pantalla en mi moviles muy guapo.........,le mando mogonllon de besos y a gabriela tambien
Fecha: 2008-08-12 09:12:04

natalia escribió:
yo ojala prodria conocer a los personajes pero daigual porque viendo la pelicula pareca que estan ahi asi que ese es mi comentario
Fecha: 2008-08-12 13:20:07

maria escribió:
hola soy maria y les digo k me gustais mucho y sobretodo a vannesa k le pido k le doy y k ves muchos besos de mi y a su pareja pega pk me gusta tambien muxo k muxo a su pareja eres muy guapo ¡¡ muchos besos los kiero a toods y sobre todoo a vanessa y su pareja
Fecha: 2008-08-12 09:29:14

ana escribió:
gabriela y troy soys los mejores m gustays un monton y las pelis son super guays la mejor es la 2 segid asi!!!!
Fecha: 2008-08-12 09:36:57

elena escribió:
ola soy elena de un pueblo de granada tocon de illora me encanta high school musical 1 y 2 ahora estoi esperando para ver el 3 vais a venir por granada algun dia me gustaria saberlo
Fecha: 2008-08-12 09:44:44

ana escribió:
gabriela y troy soys los mejores m gustais un monton y las pelis son super guays la mejor es la 2 seguid asi!!!!
Fecha: 2008-08-12 09:53:16

aldana escribió:
tengo todas las peli de ustedes y los personajes que más me gustan son: Troy,Gabriela, sharpey,Rayan y Teylor. besos Aldana Araya.
Fecha: 2008-08-02 18:56:21

kim escribió:
hola soy kim soy vuestra fan numero uno tengo todos las peliculas y estoy esperando k salga 3 para comprarla. y tambien estoy deseando ir ha verla y se k high school musical3 va ha ser un peliculon. adios wapos y wapas,os kieroooooooooo bbbbsssssss ciao.
Fecha: 2008-08-21 14:04:25

jaquelìn fabiola madrid garcia escribió:
hola a todos les quiero contar q high school musical 1 y 2 es lo mejor q hay y ya estan anunciando la peli 3 y zac efron es un guapot yo soy fan no.1
Fecha: 2008-08-12 14:33:45

yas escribió:
me encanta hsm y hsm2... me fascinó soy una de las millones de fans nº 1 de ellos... Troy es el ++++++ lindo de todo el universo tengo pósters, pelis, imágenes... ellos, porque me encantan!!! viva: TROY + GABRIELA
Fecha: 2008-08-02 19:09:20

doris escribió:
hola todos son requetecheveres ojo se dejan ganar de somos tu y yo
Fecha: 2008-08-02 20:22:21

tomas escribió:
Fecha: 2008-08-02 21:09:00

alicia escribió:
me encanta hig scool musical las doss peliculas y seguro k la tercera tambien me gustara troy gabriella
Fecha: 2008-08-03 03:54:59

MaRtA escribió:
A mi me gusta high school musical... yo soy una de las fans nº 1 sus actores son muy guapos sobretodo Troy tengo casi toda la ropa de high school musical Gabriella tambien es muy guapa y me gustan mucho los papeles que tienen mis actores faboritos son Troy y Gabriella.
Fecha: 2008-08-12 10:43:34

sole la divina de la moda escribió:
holis soy sole la reina de la moda bueno de encanta todo lo de aca bay bay...
Fecha: 2008-08-03 09:04:41

eva escribió:
a mi me gusta troy y grabiela lo que mas me gusta de la pelicula high school musical 2 es cuando se besan troy y gabriela
Fecha: 2008-08-03 12:17:47

leamny daiana escribió:
hola como podeis ver me gusta mucho high school musical me se casi todas las canciones
Fecha: 2008-08-21 12:04:23

alejandra escribió:
zac eres lo + d lo + t amooooooooooo
Fecha: 2008-08-21 13:43:07

belinda sanchez escribió:
hola zac eres el chico mas guapo del mundo dentro de la pantalla y fuera en mi colegio tenemos un club de fans de high school musical.Serias tan de agregar mi msn es por favor te lo dice una que tine toda su habitacion toda de cosas de high school musical.Tamibien se lo digo a vannesa,ahsley,lucas,cobrin y a monique.Por favor os lo dice vuestra fan nº1 del mundo plis .kits. Belinda.
Fecha: 2008-09-04 15:33:35

valen escribió:
Gabriela esre guapisima, y de ti Troy q eres el mejor guapisimooooooo suerte
Fecha: 2008-08-14 11:41:28

fabi escribió:
chicos soys los mejores del mundo mundial troy me muero por ti
Fecha: 2008-08-14 11:45:45

valen escribió:
quero el msm de troy, gabriela y sharpey.......... besotes sobre todo a ti troy
Fecha: 2008-08-14 11:49:24

bele escribió:
ola me agustado high school musical
Fecha: 2008-08-14 12:09:22

melany escribió:
soy una de las primeras fan de zac efron y de grabriela me gusta mucho las peliculas de high school musical la 1,2,3 las he visto un moton de veces mas de 10 por q me gustan mucho y troy y gabriela soys los mas guapos de las peliculas tambien brayan y sharpey soys los mas guapos un besote muy gordo`para todos los de la pelicula.
Fecha: 2008-08-14 13:15:56

melany escribió:
la pelicula dehsm3 todivia no porque esta recien saliendo en cine
Fecha: 2008-08-14 13:24:04

Maitee Puentes escribió:
oly hsm soy la mas fanatica de ustedes algun dia nos vamos a conocer xau besos y abrazos.
Fecha: 2008-08-14 20:45:04

carlitos fonseca escribió:
hola ashley como estas bien te quiero mucho y quiero conoserte te quiero bye
Fecha: 2008-08-14 20:50:54

Maria Gabriela escribió:
Hola yo soy maría gabriela y me encanta high school musical 1 y 2 y estoy emosionadisima por high school musical 3 y mi personaje favorito es gabriela y hasta tengo un afiche que es grandototote de high school musical 2 O sea es enorme yyyyyyy yo tengo una amiga que su persona je favorito es sharppey y a ella y yo nos encanta high school musical 1 y 2
Fecha: 2008-08-29 20:13:58

sandra escribió:
a mi me encantaria ser una estrella disney channel como vosotros una estrella k supiera cantar,bailar,actuar...seria mi gran sueño
Fecha: 2008-09-09 09:30:19

CANDE escribió:
Fecha: 2008-08-15 00:26:48

marta grau lazaro escribió:
ami me gusta mucho jonas brothers!!! soy su MAYOR FAN!!!!!
Fecha: 2008-08-15 04:02:55

mariA escribió:
troy bolton esta bueno
Fecha: 2008-08-15 08:00:36

patricia escribió:
me encanta el musical con sus personajes ademas cantan muy bien aunque a troy le doblan la voz
Fecha: 2008-08-16 06:20:43

sara escribió:
gabriela estas muy bonita y eres muy divertida
Fecha: 2008-08-15 08:49:06

nuritxu escribió:
hola a todos yo kiero a todos de high school musica y tengo el messenger de zac vanessa y ashley
Fecha: 2008-08-15 09:48:32

lidia escribió:
si algien famoso me escribiera en el msg como troy zac hanna montana seria my suaño hanna montana yo soy tu mallor fan de todo el mondo soy de la mojo
Fecha: 2008-08-15 10:50:10

alba escribió:
hola bueno pues que querria saber si alguno de los de high school musical tiene messenger y bueno que si tiene me gustaria mucho hablar con ellos,,soy una gran fan de todos sobre todo de zac,lucas,aslhey y vanessa y bueno me encantaria contactar con ellos no se si lo leereis los de high school musical este mensaje pero si lo leeis quiero deciros que soy lo mejor y bueno que ojala os conociera en persona o por el messenger si teneis bueno me tengo que ir!! bye bye! i love you
Fecha: 2008-08-16 07:30:47

marta y judith escribió:
somos fans de high school musical todos son guapos i simpaticos.i las 2 pelis han sido muy divertidas.
Fecha: 2008-09-11 14:53:42

maria escribió:
hola vanessa soy un fan tulloa muxo besos
Fecha: 2008-08-15 12:06:40

miguel escribió:
hola ashly i vanessa i zac soi vuestro fan numero uno
Fecha: 2008-08-16 06:29:44

soraya escribió:
hola vanessa tengo un poster y mucahas cosas tuyas zak eres un bombon me gustaria ver ya hsm3 mandame algo zak y vanessa
Fecha: 2008-08-16 08:53:04

sandra escribió:
buenas,,Qeé taaL? A mii me encanta high scholl musical me sale para bajarme muúsica de ellos para el movil y.. ¡no m deja jugar!
Fecha: 2008-08-22 02:40:09

iliana escribió:
son espesiales todos el que quiera ytenga msn agregenme para cobersar sobre lo chulo que es high schoolmusical mi msn es /
Fecha: 2008-08-30 07:01:41

maría escribió:
hola zac,hola vanessa, tengo una tabla de surf de hsm y es muy chula. me gusta mucho hsmke me mandarais algo, me haría tan feliz. zac te kiero.eres el mejor. xao vanessa. xao hsm sois los mejores os kiero
Fecha: 2008-08-16 09:02:29

Mayra Agustina Torres escribió:
soy la mejos fan de zac efro ,somos el uno para el otro soy tan the best!
Fecha: 2008-08-16 10:54:19

oihane lindsay llaguno escribió:
hsm me encanta soy una gran fan me gustaria conocerles
Fecha: 2008-08-16 14:01:27

Maria escribió:
soy fan suya
Fecha: 2008-08-16 15:00:13

irene escribió:
deverian aver menos cancioes
Fecha: 2008-08-22 08:28:13

anahy escribió:
hola soy mia la de rebelde escribo para decir que high scool musical es lo mejor me late un monton y yo que soy famosa tambien miro programas de caricaturas un besito .........que difisil es ser yo¡¡¡
Fecha: 2008-08-22 08:30:17

alex escribió:
asley quiero decirte que estas super buena i que quiero tu msn te quiero guapa
Fecha: 2008-08-17 05:37:56

alexandra escribió:
a mi me gusta muxo hsm 1 i 2 pro i´m ansiosa para hsm3 y para camp rock¡¡¡¡!!!!!
Fecha: 2008-08-17 06:25:01

david escribió:
high school musical es guay pero megus mucho mas hanna montana.chaoooooooooooo
Fecha: 2008-08-30 09:12:04

dulcemaria escribió:
ami m gustaria k los juegos q ai se pudiesen jugar en el oprdena por ejemplo el de hsm 1 y 2 pero veo q no se puede eso es injusto!!!! pero m encantaria q camp rock lo exaran mas pronto ia q empiezan los estudios en septiembre
Fecha: 2008-08-17 07:50:36

eve,carla y carlos escribió:
nos encanta high school musicAL Y NO NOS HEMOS PERDIDO NINGUNA pelicula ya estamos impacientes esperando la de fin de curso
Fecha: 2008-08-17 12:48:02

candela escribió:
high school musical me encanta y mas troy por que es wapiiiiiiiiisimo ha! estoy muy nerviosa por que kiero k salga ya la peli me encantaissssssssss
Fecha: 2008-08-17 13:50:14

maria escribió:
hola a todos soy una superfan de high school musical.Sois la caña.Gabriella eres la mejor.Troy eres la caña.Sharpay eres unica.Ryan super chulo.Chad juegas mu bn al baloncesto y saltas a la comba k t cagas.Taylor eres wpisima. Todo esto para vosotros los de high school musical de una superfan 100%
Fecha: 2008-08-22 10:32:29

jeni escribió:
yo creo que de berin poner juegos de high schoo musical a mi me fasina y tembien camp rok hanna montana me gustari jugar pero es que esto es una injusticia deberian poner los juegos
Fecha: 2008-08-17 15:48:04

miriam escribió:
me encanta disney channel pork puedes : raven,hananna montana,cory en la casa blanca...Pro lo k + m gustaria es k sacaran en el cine high school musical 3.Y tambien conocer a hananna y a reven y como no a zac y a vanesa.
Fecha: 2008-08-17 15:55:03

pepo escribió:
amo a ashley tisdale
Fecha: 2008-08-17 21:33:07

lala escribió:
a mi me encanta ashley tisdale y sobre todo zac efronz ademas chicas tengo el E-mail de zac efronz y ahora mismo estoy hablando con el
Fecha: 2008-08-18 05:04:42

Jaime escribió:
Sy el fan numero1 de haigh school musical
Fecha: 2008-08-18 08:27:20

andrea escribió:
hola a todos estoy supper nerviosa .tengo muchisimas ganas de que saquen high school musical 3.a y me han dicho que no sales en la 4 es verdad zac. sois buenisimos unas amigas mias y yo nos encantaria que hicieseis una gira por españa ok.please
Fecha: 2008-08-22 10:36:21

Paula escribió:
Sarpay,eres un poco agarrada con tu hermano y con Gabriella pero cantas bien,Gabriella,cantas genial y eres muy simpática,Troy,cantas muy bien y eres muy guapo y el de los pelos para arriba debería ir a la peluquería pero es guapo.UN BESO.
Fecha: 2008-08-22 11:50:49

jose escribió:
molla mazo
Fecha: 2008-08-22 12:03:34

laura escribió:
hola soy laura tengo 14 años soy de vigo y no m pierdo na de high school musical m encanta y mas x zac k esta mu wueno y x el amigo de zac k se m olvido el nombre el negrito de pelo de escarola k no se ofenda plis weno gracias un besazo xao
Fecha: 2008-08-30 12:20:55

kristell escribió:
hola jj ke guuapos soys todos bua ojala os conosiera y soy uno de buestros fans
Fecha: 2008-08-18 14:45:57

gabriela Alvarez escribió:
amo a zac efron hsm es lo mejor
Fecha: 2008-08-18 15:30:38

paula escribió:
desde que descubri High school musical no paro de ver sus pelis y sus fotos OS QUIERO
Fecha: 2008-08-30 10:33:25

neyra escribió:
hola zac eres lo mejor, el mas hermoso me encanta todo vesos me llamo neyra
Fecha: 2008-08-30 11:23:48

luisana escribió:
hola sak como estas eres bellisimo te amo tengo 18 años y tu quieres ser mi novio si o no dime
Fecha: 2008-08-18 16:23:29

erika escribió:
hola gabriella eres guapisima ojal fuera como tu besitos
Fecha: 2008-08-18 17:07:17

ximena escribió:
hola q tal
Fecha: 2008-08-18 18:57:33

lokaya escribió:
holas mirad a mi me encanta superfan y tengo todo lo q a salido de hsm. solo decir q zac esta bueniisiiiiiimo y q tengo ganas de ver la ultima carla
Fecha: 2008-08-22 14:13:03

Rakel escribió:
Hola soy Raquel y desdes que vi High School Musical me emociono mucho y cada vez que sale una edicion nueva estoy ansiosa por verla.
Fecha: 2008-08-19 03:50:13

Lorena escribió:
high school musical 3es lo mejor zac tkm y vanessa tambien oye me encanto conocero vuestro manger esmi tio y zac el otro diste muy prontoia se me olvio de cirte en elmsn q te fuiste muy pronto a y ingles pa habla con tigo me ayudan y gual q con tos jiji
Fecha: 2008-09-01 14:19:39

Daniel escribió:
yo quiero que pongan el High School Musical si no es que no saben hacer el programop de Disney Channel vale adios , a i protesto por lo que e dicho
Fecha: 2008-08-19 04:57:20

julissa escribió:
hola como estan ami me encanta zack efron y ashlie tisdale me gusta el papel de troy y de sharper y me gustan todas las peliculas de hsm,hsn2y la de hsm3 me enfasina espaero que me contestes adios mando saludos a vane,zack,ashlie,lucas,corlin y a monica adios saludos a todos bayyyyy muuuuuuuaaaa
Fecha: 2008-09-17 20:14:20

anna escribió:
hola soi anna i no se a quien le estoi ablando
Fecha: 2008-09-05 02:53:55

virginia markland escribió:
Fecha: 2008-09-01 14:06:57

MARI ANGELES escribió:
Fecha: 2008-08-19 08:03:36

samuel martínez escribió:
soy fan de hig school musical 3 fin de curso
Fecha: 2008-08-23 05:17:55

alba escribió:
me gustas zac
Fecha: 2008-08-19 08:04:14

ane escribió:
os queria comentar que me gustan las tres peliculas de high school musical y otra cosa vanessa cantas muy bien zac eres muy wapo corbin eres mas wapo ashley en la peli eres mandona pero en realidad eres sinpatica y dibertida lucas eres wapo monique eres muy wapa
Fecha: 2008-08-19 08:44:25

elena escribió:
holaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa me encanta hanna montana my abitacion es entera de ella y boy a todos lox conciertos de ella
Fecha: 2008-08-19 08:45:31

Selene escribió:
Fecha: 2008-08-19 09:54:54

javier escribió:
holaa a mi me gustaria que pudiesemos cantar y que nos puntuaran
Fecha: 2008-08-19 10:29:23

jade escribió:
me encanta troy y vanesa son los mejores no me he perdido ninguna de sus peliculas y por supesto no me pienso perder high scool musical fin de curso va aser toda una pasada me moriria si troy en persona biniera a mi casa pero no quiero que eso pase por que no le entenderia nada lla que el abla en ingles muuuuuchos besos
Fecha: 2008-08-31 05:24:16

Maria escribió:
Hola soy la fan numero 1 de los Wildcats y sobre todo de Vanessa Anne Hudgens eres guapisima me encantaria conocerte en persona.Cuando sea mayor voy a ir a america a ver si te veo aunque no se si te reconoceré.Muchisimos besos.
Fecha: 2008-08-23 09:49:35

roberto simon paola mateos escribió:
nos gusta mucho high school musical sobretodo gabriela y troy vosotros los otros actores no os ofendais por que tambien sois vueos actores muchas felicidades por la pelicula high school musical 3 está muy chula muchos besos desde España (extremadura plasencia ) chaoooooooo
Fecha: 2008-08-30 16:24:50

alba escribió:
me encanta disney channel me estoi pasando dia y noche para verlo os quiero y si me gutaria darles un beso a los jonas brothers BESSSSSSSSSSOOS
Fecha: 2008-08-23 13:06:20

tamara escribió:
la peli debe estar re buena porq´ yo ya vi la 1º peli y la 2º parte la tercera de be estar re re re re re re re re re pero re re re re re re buena le digo a tatiana boluda q yo soy la fans numero 1º de high shool musical soy la mejor de la mejores tamy ja,ja,ja
Fecha: 2008-08-23 14:14:46

Marta escribió:
Troy te admiro un monton
Fecha: 2008-09-04 10:35:12

alex escribió:
en los anuncios me gusto vuestra musica y vuestros impresionantes bailes y cuando estais en la piscina, Bolton creó un gran baile en el baloncesto la verdad es q bailais fenomenal mente bien
Fecha: 2008-08-31 07:23:49

laura escribió:
Fecha: 2008-08-31 08:44:10

angela escribió:
me encanta esta peli y espero que pronto saqueis muchas mas . las canciones y los bailes es lo que mas me gusta . sois los mejores ¡¡¡¡ fecha:2008-05-08 10:20:49
Fecha: 2008-09-05 03:48:49

carolina herrera leal escribió:
Fecha: 2008-08-30 14:18:22

lobna escribió:
high school muisical 3 ha sido lo mas espero que podais hacer high school miusical 4 pero os queria decir que tengo todo vuestro
Fecha: 2008-09-05 08:25:43

mariana blanco rodriguez escribió:
hola queridos amigos me llamo mariana amo la pelicula de high school musical yo quisiera que fuera asta la 9 o mas es fabulosa la peli tengo todos mi utiles escolares de high school musical mi lapiz plumas estuche mochila cuadernos ect. adios los adoro
Fecha: 2008-08-19 20:16:51

sara escribió:
hola mellamo sara, y os adoro, me gustaría que hubiese 9 películAS DE HIGH SCORE MUSICAL
Fecha: 2008-08-20 02:54:20

andrea escribió:
hola mellamo andrea y soy muy fans de ustedes me gustsris qe hubiera asta la peli high eschool musical que saliera asta la peli 10 y porfabor combien las fotos de internet que las tengo todas de parte de andrea
Fecha: 2008-08-20 04:31:57

marta escribió:
Fecha: 2008-09-10 08:58:27

metztli leilani lorenzo matus escribió:
hola les quiero desir q me encanto la pelicula nunca me la perdia
Fecha: 2008-08-23 21:51:51

patty escribió:
High scool musical es una pasada lo e visto tantas veces!! qee por eso me encanta os felicito a todos por lo qee aveis exo i aveis travajado ,os qeruu muxoo wapos/as!!
Fecha: 2008-08-20 04:56:44

natalia escribió:
Fecha: 2008-08-20 05:34:54

yamiley escribió:
ola me llomo yamiley y esta mos a sien do un grupo para se famosas iki en kiera se famosa numero 1 ke no akla re anosotras la nenas bonbassssssssssssssss
Fecha: 2008-08-20 07:43:15

tatiana escribió:
hola soy tatiana y soy fanatica 100% de high school musical es lo mejor y cuando lo estan dando no me puedo evitar a verlo
Fecha: 2008-08-20 08:13:52

raquel escribió:
me encanta esta serie soi la fan numer 1 i ai un chico que me mola os kiero raquel!!!
Fecha: 2008-08-24 06:53:31

samantha escribió:
amime encanta
Fecha: 2008-09-10 14:47:34

carla escribió:
la peli antes no me molaba pero despues la vi varias veces y me encanto es xulisima sobre todo las canciones¡¡
Fecha: 2008-09-04 10:01:20

anonima escribió:
ami me gusta mucho pero el que mas me gusta es ZAC EFRON.
Fecha: 2008-09-04 10:03:34

morelia escribió:
hola soy la fans numero 1 de high school musical,colecciono sus peliculas.A mi me gustan todos los personajes de high shool
Fecha: 2008-08-24 10:35:22

itala escribió:
chicos yo soy su fan numero 1 , yo veo todas sus peliculas y quisiera tener la pelicula de haig school musical 3
Fecha: 2008-08-24 11:33:19

Allyson escribió:
Fecha: 2008-08-24 19:23:32

naryis escribió:
hola sac megstas mucho eres muy guapo rengo muchas fotos tuya y sabes jugar mucho al balonsesto. ases un pareja muy bonita tu y vanesa adios tktktktktktkt
Fecha: 2008-08-25 07:18:49

yalila escribió:
esta muy bien la pelicula
Fecha: 2008-08-25 07:49:26

claribel escribió:
hoola zac me gustas tuestas gapisimio y todos tus amigos y o digo k tu y vanessa hacen una bonita pareja pos cuidense besos
Fecha: 2008-08-25 10:08:31

rakel escribió:
soy la myor fen de zac efron
Fecha: 2008-08-25 11:30:22

krista escribió:
esque osea high shool musical es lo mejor.....pero lo mejor es zack efron uuuu!!! q lindo q es!! un saludo y un kiss
Fecha: 2008-08-31 13:30:16

AGUSTINA escribió:
Fecha: 2008-08-25 15:49:49

anabel escribió:
high school esta guai y esa serie esta muy bien porque mas que nada es una serie musical
Fecha: 2008-08-25 16:46:29

juleta escribió:
hola!! a mi me encanta zac efron!! es re lindo!! bueno!! me voi!
Fecha: 2008-09-12 15:07:14

sofia escribió:
quiero conseguir cosas para el messenger
Fecha: 2008-09-12 15:39:48

NATALIA escribió:
Con mis cinco añitos soy una superfan de high school musical. Esta pequeñaja está contando los días, junto a su amiguita María, para el estreno de la 3ª parte de la peli. ¡Ya queda poco!
Fecha: 2008-09-02 09:41:25

alan escribió:
como os va vien o mal yobien
Fecha: 2008-09-02 06:11:27

beatriz escribió:
a mi lo que me canta es high school musical gabriela yo tanmien tengo verguenza cuando canto delante de jente lo unico que digo sige a lante y nunca pares troy bolton estas buenisimo eres especial para mi un beso a todos de high school musical
Fecha: 2008-09-02 07:04:45

cristinayevita escribió:
me gusta muchisimo high school musical Son mis fans
Fecha: 2008-08-31 15:29:22

iñigo escribió:
a me me enkanto la un un montos espero k saken muchas+¿¿¿???
Fecha: 2008-08-26 07:35:14

abigail escribió:
me gusto porque es una peli chulisima espero que se hagan aun mas pelis y que sigan siendo chulisimas
Fecha: 2008-08-26 08:18:44

marzela escribió:
hola ashley te quiero mucho soy tu fan n.1 tengo todo tuyo y si tu kieres espero algun dia llegar a conocerte. te quiero mucho sharpay
Fecha: 2008-09-10 18:33:08

lucia escribió:
sois los megores del mundo estoy deseando de que salga la pelicula high school musical 3 fin de curso ¿cuando sale? besasos a todos los de high school musical
Fecha: 2008-09-01 08:59:20

maili escribió:
soy una fan de disney channel y me gusta mucho hana montana y reyven y cam roc bueno besicos a todos
Fecha: 2008-09-02 09:50:42

zape escribió:
me an gustado mucho las peliculas de hsm (1y2, y espero q la tres tambien me guste. ya me se todas las canciones de las dos pelis.BSS ¡WAPOS!
Fecha: 2008-08-26 08:46:16

patricia escribió:
pues kisiera ablar contodos es te es mi mesenger
Fecha: 2008-09-02 09:52:02

katrina jamile cabrera ribera escribió:
mola mazo hai scul miusical
Fecha: 2008-09-13 03:14:32

laura escribió:
hola me gusta mucho de los personajes sharpay y zac.
Fecha: 2008-09-06 14:32:00

carlos escribió:
soy fan de blue water ahij y me encantan att`` carlos
Fecha: 2008-09-02 06:03:37

MAITE escribió:
A mi me gusta high school musical poque tiene unas pelis muy entretenidas y bonitas un besazo para todos
Fecha: 2008-09-01 03:19:29

paloma carrasco garrucho escribió:
me ha encantado hihg schooll musical 2 es muy interesante y me ha gustado muxo la pelii a mis amigas tmbn. soyss los mehoree pero troy y vanessa mas xdd aslhey es muy presumida y se cree k es la mejorr y no lo es . lleva muxo tiempo detras de troy pero a el le gusta vanessa jeje saludoss besoss xddd
Fecha: 2008-09-01 06:24:21

ivan stiben escribió:
ola soy ivan mencanta disneichnel pero esque ay otro que megusta
Fecha: 2008-09-02 07:21:19

andrea escribió:
zac vanessa aceis muy buena pareja me encanta como vailais y como cantais sois los mejores!!!!!¡¡¡¡¡
Fecha: 2008-09-06 12:32:56

ines escribió:
hola a todos los de high school musical me a gustado un monton vuestras pelis (1y2) en disney channel en septiembre echan high school musical 3 y espero que me guste high school musical los personajes favoritos son zac y vanessa y zac me pareces muy guapo casi toidas las de mi clase te quieren pero yo la que mas muchos besoa a todos adios guapos
Fecha: 2008-08-26 12:30:01

patricia escribió:
pues kisiera ablar contodos es te es mi mesenger
Fecha: 2008-09-02 09:52:06

angel escribió:
soys muy buenos agregarme please me encanta buestas peliculas
Fecha: 2008-09-04 13:16:06

isabel escribió:
yo creo que tienen que haber juegos que pongan para vestir a vanessa a zac etc...
Fecha: 2008-09-02 10:02:04

katrina jamile cabrera ribera escribió:
mola mazo hai scool miusical 2 me gustaria saber el nombre de gabriela en realidad y una foto mandame-la a al msn cue tienes arriba ok chica
Fecha: 2008-09-13 03:21:14

amalia escribió:
yo quiero que por mi correo me madeis una nota para conoceos un poco mejor vale y que quiero que enpiece la pelicula de fin de curso.
Fecha: 2008-09-05 09:04:12

andrea escribió:
troi eres el mejor me encanta como bailasme gustaria aprender tus pasos y ya estoi deseando ver high school musical3 un beso tu fan andreak te kiere mucho
Fecha: 2008-09-05 10:01:24

anais escribió:
hola soy anais me encanta troy es muy guapo y gabriela no se queda atras
Fecha: 2008-09-05 10:02:10

andrea escribió:
troi eres el mejor me encanta como bailas me gustaria aprender tus pasos y ya estoi deseando ver high school musical3 un beso tu fan andrea k te kiere mucho.
Fecha: 2008-09-05 10:02:52

paula escribió:
para mi los mejores personajes de high school musical son vanesa y zac¡¡¡¡¡viva high school musical!!!!!y tambien viva todos los personajes de high school musical ¡¡vivaa!! xao bess
Fecha: 2008-09-02 11:04:49

esther escribió:
quiero el Email de todos los de high school musical
Fecha: 2008-09-05 11:14:56

AnA escribió:
mencanta los personajes de high school msical sobretodo troy y gabriella
Fecha: 2008-09-05 11:21:43

raquel escribió:
ola, soy raquel, mirar, m encanta high school musical, si habeis bisto a hanna montana es mejor k no, pusieron una doble en un concierto, y pense k high school musical no lo haria pero SÍ lo han echo, con zac efron m e quedado tan mal.. encima m ice fan d rbd y ahora s separan estoy liada, pero aun asi lo de la gira d hsm m da iwal seguire siendo siempre la niña k lo tiene todo d hsm, una superfan
Fecha: 2008-09-02 13:03:31

cristina escribió:
estoy deseando de ke pongan high school musical 3 para verlo. lo ponen el día 24 de octubre de 2008 en disney channel. mi favorita es taylor y mi favorito es troy. es el tio mas guapo del mundo
Fecha: 2008-09-02 13:42:26

angel escribió:
soys muy buenos
Fecha: 2008-09-04 13:14:09

maria escribió:
high school musical soys los mejores me encantan como cantais como vailasis y como actuais soys los mejores agregarme
Fecha: 2008-09-05 11:48:03

romina escribió:
estoy muy entusiasmada por ver high school musical 3 que guay espero que entre a la benta ya ya ya ya y ya
Fecha: 2008-09-05 12:16:40

loca1 escribió:
estoy deseando de ke pongan high school musical 3 para verlo. lo ponen el día 24 de octubre de 2008 en disney channel. mi favorita es taylor y mi favorito es troy. es el tio mas guapo del mundo
Fecha: 2008-09-02 13:43:22

tamara escribió:
hola zac sos muy lindo pero joe jonas t gana es haci
Fecha: 2008-09-02 13:47:22

tamara escribió:
hola les queria contar q zac sos muy lindo pero joe jonas t gana es haci vos sos lindo pèro joe es hermoso lindisimo bueno espero q lo hacepten chauuuuuuuuu
Fecha: 2008-09-02 13:50:16

zaira escribió:
Fecha: 2008-09-02 14:28:57

Camila escribió:
Soy Camila una super fan de high school music,me encanta Troy Bolton,gabriela es dulce pero sharpey la mejor .Veo todas las series del canal de Disney,sois los mejores!!!Way H.S M 3 k llegue a 10!!!!
Fecha: 2008-09-02 16:40:47

rakel escribió:
Fecha: 2008-09-05 13:11:03

erika escribió:
ola me encanta high school musical es muy guayyyyyyyyyy mandarme una foto con todos bosotros aaa espera eres muy guapo zac xao
Fecha: 2008-09-09 10:30:39

cristina escribió:
hola troy,gabriela,rayan i sharpay.Mencanta vuestro video de high school musical3 fin de curso.
Fecha: 2008-09-03 02:27:01

clara gomez escribió:
toda la gente k ha escrito esto es una farsa yo soy la mejor y amo a zac efron(troy volton)estoy esperando a k salga high scool musical 3
Fecha: 2008-09-03 04:06:22

marta escribió:
me encanta high school musical quiero que hagan una serie de television seria genial verlos todos los dias
Fecha: 2008-09-05 13:30:26

oscar casero escribió:
high school es la mejor serie me gustaria conocer a troy i a gabriela
Fecha: 2008-08-26 15:58:35

paula escribió:
Fecha: 2008-08-26 16:34:09

marianela escribió:
yo encuentro que los mejores de la peli son troy y sharpay porque 1 sharpay es mi idola y troy es amigo de sharpay para q vean esas niñas q apoyan a gabriela son puras lusers ja lusers
Fecha: 2008-08-26 18:57:18

samuel acosta escribió:
zack eres un crack dame tu messenger yo te doy el mio
Fecha: 2008-09-05 16:12:29

yamilex escribió:
quiero mucho a vanesa y zac los quieros atodos beso para ti vanesa y zac beos paratodos muchos besossssssssssssssssssssssssssssssssssssssss
Fecha: 2008-08-26 21:32:10

yamilex escribió:
los mejores de la pelicula son troy y graviela por que son los pretagonitas y aesas baby que apoyan sharpay lusers ja ja doble ja pura lusers osea amiguis bajen de esa nubes behan la rialidad lusers jaja doble ja jajajaja
Fecha: 2008-08-26 21:40:08

beatriz escribió:
soy vuestra fan numero1 sois geniales mis favoritos son vanesa y zac mi msn es beitaniesan@HOTMAIL.COM AGREGARME PORFAVOR
Fecha: 2008-09-03 09:00:47

texi escribió:
hola,son guapisimos todos , sobre todo tu zac tu fan, texi
Fecha: 2008-09-06 08:49:46

natali escribió:
nunca os e visto pero vuestras canciones son la bonba
Fecha: 2008-09-03 09:20:05

maria escribió:
troy esta como un queso
Fecha: 2008-09-03 10:45:39

miriam escribió:
a mi me encanta rebelde y hig school musical poreso estoy deseando ber la peli de :hig school musical 3 fin de curso
Fecha: 2008-09-06 01:55:24

luna escribió:
Fecha: 2008-09-06 05:15:26

angela escribió:
me encanta las peliculas no me las pierdo nunca bueno chao
Fecha: 2008-09-03 04:50:30

pame escribió:
son la boooooooooomba nadie les supera. seguir arrasando asi k llegareis muuy,muuuuuy,muyy,lejos . wwwwwwwwaaaaaaaaappppppoooooossssss
Fecha: 2008-09-03 05:24:34

yasmin y ainhoa escribió:
Las series son geniales,sobretodo Hanna Montana.vais a poner alguna serie nueva? seguro que sera genial. mil besos y un saludo
Fecha: 2008-09-03 05:33:52

noEliA** escribió:
las pelis k mas me an gustado de momento an sido high school musical, salta y como no camp rock sois los mejores JB
Fecha: 2008-09-03 05:47:02

paloma escribió:
Ojala conociera a zac y a vanessa os quiero muchisimo estoy deseando ver la 3 parte no os separeis me morire como os separeis.tengo 10 años y medio pero os quieroooooo mucho vuestra fan nº1 paloma
Fecha: 2008-09-06 06:40:38

ROCIO escribió:
Fecha: 2008-09-03 10:51:41

abi escribió:
HOLA... queria decirle q son ls mejores,y espero q se conecten con migo
Fecha: 2008-09-03 11:00:42

rosa escribió:
hOla k tal guapos de high school musiical gUUUUUUUUUUUaaaaaUUUUUU
Fecha: 2008-09-03 12:29:04

tamara escribió:
hola les qeria decir zac sos muy lindo pero joe jonas t gana es haci sos lindo pero joe eshermoso chauuuuuuuuuu
Fecha: 2008-09-03 13:57:03

sonia escribió:
olasoy sonia la rubita me encanta la vanesa,el zac y la asley son los megores del mundo mundial.adios xau bay.
Fecha: 2008-09-03 06:10:13

zarai escribió:
Fecha: 2008-08-27 11:52:56

alia escribió:
me en canta buestra pelicula y ademas me gusta mucho ke la agais bosotros
Fecha: 2008-08-27 11:54:39

sofia escribió:
me encantan los juegos son geniale y es la primera ves que veo la pagina SOFIA
Fecha: 2008-08-27 13:03:51

tamara escribió:
hola zac es el mas hermoso de todos lo amo no veo la hora de qye salga la 3 un beso a todos aguante zac y vanessa hudgens!!!!!!!!!!!!!!
Fecha: 2008-08-27 13:30:27

maria olcina escribió:
hola.Holala Zac eres muy guapo y Vanesa tambien.Sharpey eres guapa,Rayan tambien,Chad y Teyrlort tambien.Soy una fan vuestra me gustaria conoceros.agregame en tu msm el mio es plis,te lo dice una fan.Besos.
Fecha: 2008-09-03 14:59:23

Cecilia salomon escribió:
Zac me encanta es el mejor mejor mejor de todos vanessa es una tonta es la peor sharpey es hermosa quiero Que salga con zac la mejor paraja
Fecha: 2008-09-03 15:51:32

guayaba americana escribió:
me gustaron mucho las peliculas pero deberian de pasar mas de 3
Fecha: 2008-09-15 12:59:01

meata escribió:
siy marta y soy una fat vuestra.
Fecha: 2008-09-12 10:31:28

mireia caulas escribió:
ola me llamo mireia pero me llaman mire.vanesa tienes suerte de besar a zac eres muy afortunada.posdata me das tu autografo.a i poque le dais un juego a Sofia i a mi no.gope.
Fecha: 2008-08-27 14:01:04

alba escribió:
soy los mejores pero vanesa es la mejor de todos un saludo y un beso
Fecha: 2008-08-28 13:35:49

mireia escribió:
ola me llamo mireia y soy de catalunya.estoy sufriendo para ver HSM 3 fin de curso! vanesa,zac y ashley son guapisimos. si kereis mi msn es:
Fecha: 2008-09-03 08:25:34

rosa escribió:
me encanta high school musical y estoy deseando de qe empiece la 3.HSM LO MEJOR
Fecha: 2008-09-06 07:07:13

PAULA escribió:
hola me llamo paula troy me gusta y gabriela son los mejores besos
Fecha: 2008-09-03 08:59:46

miriam escribió:
la peli
Fecha: 2008-09-04 08:04:55

cintia escribió:
me encanta high school musical
Fecha: 2008-09-16 09:48:53

camila escribió:
quiero que zack efron venga a mi casa
Fecha: 2008-09-12 11:53:48

miriam escribió:
la pelicula sta way pero el juego aun mas asias por aser este juego dw
Fecha: 2008-09-04 08:06:13

adriana escribió:
pos deciros k high school musical son los mejores, junto con miley...etc¡¡son los mejores muxos bss
Fecha: 2008-09-15 13:11:15

christian escribió:
hola yo no me pierdo ni un peli
Fecha: 2008-09-12 11:11:02

Marta escribió:
High school musical es lo mejorrr sguro q no me pierdo la pelicula de high school musical 3 es lo mejorrrrrrrrrrrrrrrr
Fecha: 2008-09-15 15:06:24

nora escribió:
troi tequiero eres el mejor tengo ocho años
Fecha: 2008-09-04 08:26:18

nora escribió:
troi tequiero eres el mejor
Fecha: 2008-09-04 08:26:31

elianne nathaly escribió:
porfavor zac dile a tu novia que me de una entrada a el concierto de ella ai que tambien me de el pasaje porque vivo en ecuador porfavor que le tomen mas importancia a este pais
Fecha: 2008-09-06 15:07:41

Celina escribió:
Fecha: 2008-09-06 20:54:54

fernanda escribió:
kiero ser kmo uttedesssss!! ya eesi npoo ya zhaaoo!!
Fecha: 2008-09-11 20:18:43

Shara Alejandra escribió:
hola a todos yo soy una fan de troy, de gabriela, sharpey, chad, ryan y de taylor. ami me encantan todas las peliculas que an sacado y quiero ver la 3 que me han dicho queya estan en los cines y tengo muchas ganas de verla. y de ver como haan cambiado los chicos y escuchar las nuevas canciones que las eh escuchado en la propaganda y son buenisimas. un gran beso atodo mis fansy que soy una gran fanbuestra la numero 1ª
Fecha: 2008-09-06 11:31:59

josue escribió:
es muy muy buenos los bailes¡ es lo que mas encanta
Fecha: 2008-09-04 15:05:30

paula escribió:
hola zac i vannesa
Fecha: 2008-09-13 03:43:46

lorena escribió:
me encanta esta peli estoy deseando ver 3 fin de curso va a ser un pasada¡¡¡¡¡¡¡¡¡¡ podeis agregarme
Fecha: 2008-09-04 11:13:45

yoana escribió:
zac efron esta buenissimo
Fecha: 2008-09-13 06:00:46

Natalia escribió:
Me gusta mucho la facilidad con la que trabajais con buestros compañeros. ¡¡¡Sois alucinantes!!! Si fuera posible me gustaria tener algunos de lo msn o correos de los personajes de high school musical. Gracias. Hi, I like so much how do you work together.You are incredibles!!! If it can be I want to have some msn or e-mails of the workers of high school musical. Thankyou.
Fecha: 2008-09-13 06:05:17

andrea escribió:
troy eres guapo...gabriella cantas superrr...taylor eres la mas eres el mas...pelo estrenado...rayan el terror y SHARPAY la mas presumida pero guapa TENGO 9 AÑOS Y ME ENCANTAIS TODOS ESPERO QUE ESTE AÑO TRIUNFEIS ...DA IGUAL COMO QUE TRIUNFE 1 QUE TODOS TOTAL SIEMPRE OS QUERRE
Fecha: 2008-09-07 08:27:49

andrea escribió:
troy eres guapo...gabriella cantas superrr...taylor eres la mas eres el mas...pelo estrenado...rayan el terror y SHARPAY la mas presumida pero guapa TENGO 9 AÑOS Y ME ENCANTAIS TODOS ESPERO QUE ESTE AÑO TRIUNFEIS ...DA IGUAL COMO QUE TRIUNFE 1 QUE TODOS TOTAL SIEMPRE OS QUERRE
Fecha: 2008-09-07 08:29:30

izamar escribió:
soy el fans numero 1 de high school musical siempre los estoy viendo en disney chanels me encantais me gustaria tener un cd de vosotros que no tengo ni uno y conoceros a todos en persona porfavor te quiero zac eres mi idolo numero uno
Fecha: 2008-09-11 10:48:30

elisabte escribió:
me encantais
Fecha: 2008-09-07 13:08:25

Ariadna escribió:
Fecha: 2008-09-07 15:26:54

Noelia escribió:
Zak solo quiero una foto tuya es lo unico q pido porq estas buenisimo mi msn es
Fecha: 2008-09-09 06:05:21

lesie jacqueline vargas bravo escribió:
la peli me encanta ademas me encanta mas cuando cantan
Fecha: 2008-09-07 17:20:03

anakaren escribió:
ami me encanta de hmsel desafio me gusta mucho jorge y de hsm me gusta zac
Fecha: 2008-09-07 21:13:31

paula escribió:
es super mega way me encantas zac te kiero follar enterito desde tenerife
Fecha: 2008-09-08 06:51:49

samanta escribió:
yo creo k gabriela si k pega con troy y iliana k te guste mas sharpey k gabriela no significa k sharpey pege mas con troy k con gabriela...
Fecha: 2008-09-08 09:42:38

Ana escribió:
me encantaria ser famosa como vosotros
Fecha: 2008-09-08 11:45:31

I LOVE TROY(paloma) escribió:
ZAC SOLO QUIERO UNA FOTO TUYA MANDAMELA A: por favorrrrrrrrrrrrrr adiossssssss os quiero
Fecha: 2008-09-08 12:09:45

jorge escribió:
me encantan las canciones de high school musical
Fecha: 2008-09-13 08:25:04

valentina escribió:
zac efron es tan cool y sarpei es tan bella tiene un buen estilo yo soila fan de troy de sarpei gabriela y chad forman un buen equipo y me parese demasiado cool que saquen high school musical 1 2 3 me parece tan cool
Fecha: 2008-09-15 16:06:56

carmen escribió:
es muy binito los juegos k aceis
Fecha: 2008-09-13 09:31:37

luis escribió:
me gusta mucho la pelicula camp rok
Fecha: 2008-09-13 09:43:42

luis escribió:
me gusta mucho la pelicula camp rok
Fecha: 2008-09-13 09:44:29

laura escribió:
zac eres super guapo i aces mui buena parea en vanesa i buestra pelis son buenisimas.
Fecha: 2008-09-13 10:19:02

laura escribió:
zac eres super guapo i aces mui buena parea en vanesa i buestra pelis son buenisimas.
Fecha: 2008-09-13 10:19:10

isabel escribió:
esto es para zac, eres el mejor, guapo y tambien actor, me encantas... lo malo es que ya estas pillado, bueno T.K.M de tu friend
Fecha: 2008-09-13 16:09:46

Veronica escribió:
zac,eres el mejor y muy guapo por zierto bueno t quiero 1000 besitos xao asta pronto
Fecha: 2008-09-13 17:38:45

YURIANA escribió:
Fecha: 2008-09-20 14:06:46

angelina escribió:
me encantan como bailan ami sobretodo me gustan gabriela,Zac y hasly bs
Fecha: 2008-09-14 07:48:33

alicia escribió:
Fecha: 2008-09-14 08:12:18

Marta grau escribió:
ami me gusta high school miusical pero seguro k camp rock los supera. puede k no pero os doy mi mesenger os kiero atodos bss.
Fecha: 2008-09-14 09:39:36

demi escribió:
troy gabriela sois lo mejores
Fecha: 2008-09-14 09:44:25

sofi escribió:
son lo mejores
Fecha: 2008-09-18 08:24:08

beatriz escribió:
zac efron esta como un quesito gabriela es mazo guapa a ver si os casais y teneis bombones como vosotros conectaros al msn para hablar con migo aslhey tambien es mu guapa mas q vannesa chao
Fecha: 2008-09-14 09:52:21

MaR,,,,,,=) escribió:
me encanta Disney Channel todos los dias lo veo y me gustan las series:Raven,Cosas de la vida,Yo y el mundo,Cosas de ermanas,Hotel dulce hotel,Hannah Montana, etc bueno un beso xao
Fecha: 2008-09-14 13:14:53

paula escribió:
troy bolton osea zac efron estapara comerselo y me gustaria tener du mns
Fecha: 2008-09-14 14:18:53

MELY escribió:
Fecha: 2008-09-14 14:34:56

fabiola escribió:
olap nu entiendo el juego supongo por los comentarios q ponen es aburrido .....
Fecha: 2008-09-14 15:25:39

fan de highg scool musical escribió:
ojala os conociera me gustaria cantar como vosotros ademas yo vivo en galicia con los galegiños chao un beso muy fuerte OJALA OS CONOCIESE UN BESO
Fecha: 2008-09-19 12:19:01

María escribió:
Sería bonito q huviera un juego donde se pudiera cantar con la canción favorita y le dieran la puntaación y si uno quiere le puede donar los puntos a el personaje favorito
Fecha: 2008-09-14 21:01:26

mireia cantallops lopez escribió:
HIGH SHOOL MUSICAL 12 SON GUAXIS ESPERO QUE LA 3 sea tanbienguaxi adios muxos besos.
Fecha: 2008-09-19 10:43:43

maria martin jaimez escribió:
hola high shcool musical soy una gran fan vuestra os quiero.
Fecha: 2008-09-15 06:38:28

alex escribió:
estoy desando que seamos mañana sabado 20 de septiembre porque estrenaran la nueva palicula en disney channel camp rock a y todas las series son buenisimas desde phineas y ferb hasta hanna montana vsk disney channel y claro viska io y el gimnastic de tarragona
Fecha: 2008-09-19 12:25:09

CANDELA escribió:
Fecha: 2008-09-16 16:54:41

soraya sepulveda escribió:
mencanta high shool musical y espero inpaciente high shool musical 3 me encanta vanessa y zac
Fecha: 2008-09-17 12:44:51

este banco escribió:
este banco esta ocupado x un padre y un hijo el padre se llama juan komo se llama el hijo? sale ai
Fecha: 2008-09-17 14:36:25

tefani escribió:
te amo zac efron mivida mi cielo aaa y tu vannesa eres una gran actris y shaly yo tengo tu muñeca tuya los quiero bye xd xs XD XD QP BEXOS BEXOS
Fecha: 2008-09-19 21:30:26

cristina escribió:
zac eres el mas guapo te quiero
Fecha: 2008-09-20 05:43:43

TROY VOLTON escribió:
troy es el megor que juego de valocesto y conocio a gaviela pero que gaviela yo soy fqan de troy y gaviela y me canta la canciones y entonces como soy fan de high school musical besos de cris
Fecha: 2008-09-22 15:54:19

carla escribió:
bueno cantan bien y me gusta las cansiones de ellos de high school musical
Fecha: 2008-09-22 16:16:31

valeria escribió:
vanesa quiero conoserte estubiste fantastico en la 2 vesos el grupo los amoooo
Fecha: 2008-09-23 17:24:58

lidia escribió:
odio high school musical es muy feo y solo me gusta zac pero lo demas aburrido aburrido panda de tontos
Fecha: 2008-09-30 10:09:28

TROY VOLTON escribió:
Fecha: 2008-09-21 08:02:25

Cati escribió:
Hallo zac and vanessa is lo mejores i love we.Zac Efron (troy)is beatifool.Estoy todo el dia mirando disney y mirando high school musical.
Fecha: 2008-09-21 08:47:30

belen escribió:
es fantastico sobre todo la gabriela
Fecha: 2008-09-21 08:49:04

andrea escribió:
k esta peli es mu xula de verdad
Fecha: 2008-09-21 09:06:38

yasmin escribió:
k guay k esta la peli y kiero ver la de high school musical 3 fin de curso ojala la pudiera ver ya dew os kiero muxo a todos los k salis en la peli adios un beso mu fuerte yasmin!!!!!!!!
Fecha: 2008-09-23 08:22:37

angel escribió:
me gusta mucho zac efron y tambien ashli, tambien e visto las tres peliculas, tambien me gustan las canciones y los videos. y le mando muchos vesos a zac
Fecha: 2008-09-23 18:48:00

Fecha: 2008-09-23 10:26:37

tania escribió:
sois geniales soy buestra fan numero 1 tengo mi habitacion llena de poster y cosas de high school musical tengo tres collares,unos pendientes,2 pulseras,las 2 mochilas ,el estuche ,todos los discos, las pelis ,el pigama,la bata,el arbornoz ,las zapatillas de estar por casa y un monton de ropa de high scool musical OS QUIERO BESOS BESOS BESOS
Fecha: 2008-09-23 12:12:01

anabel escribió:
Fecha: 2008-09-21 12:24:32

Peluchit0 escribió:
Troy estas KAÑONN !!!!!!!!!!!!!
Fecha: 2008-09-21 12:32:28

carlota escribió:
zac efron es el chico mas guapo del mundo y high school musical es la peli com mas ricmo del mundo y me encanta zca soy tu mayor fan y deseo conoserte y si pudiera me casaria com tigo te quiero carlota
Fecha: 2008-09-21 14:24:56

samantha escribió:
sharpey es un personaje mas guay y parece ke zac efron ase para on ella uiiiii ke emocionnnnnnn
Fecha: 2008-09-21 14:47:35

gviela escribió:
gavila es la chica mas juapa que la chica pero el chico es conocio a troy volyon canto troy gaviela juntos que es namudo de troy volton pero troy es juapo me justo a mi a troy besos parac todos
Fecha: 2008-09-21 16:20:53

anasor escribió:
yo creo qye la mas linda es ashley tisdale xq vanessa es orribe mas vien zac y ashley hacen bonita pareja. hablando de otra csa no quiero que la ultima peli de high school musical sea la 3 quieroque sigan soy su fans numero 1 los extrañaria mucho y los quiero mucho espero que leanesto i love you
Fecha: 2008-09-27 14:01:03

lili* escribió:
Fecha: 2008-09-28 01:11:03

ROCIO escribió:
Fecha: 2008-09-30 12:32:10

zoe escribió:
me encanta hannah montana kiero k pongan mas juegos
Fecha: 2008-09-28 15:39:19

gabriela escribió:
Fecha: 2008-09-30 15:34:58

natalia escribió:
jaja , ami me gusta high school musical . pero no para ver todo el rato si no para ver una vez y si tal despues de mucho tiempo otra vez bss
Fecha: 2008-10-22 11:01:46

rocket escribió:
me encanta high school musical sobre todod gabriella jajaja
Fecha: 2008-09-29 06:13:40

Sara escribió:
Me encantan SHARPAY y RYAN
Fecha: 2008-09-29 07:27:46

carolina escribió:
bua troy esta buenisimo gabriela es muy guapa sarpei es mala braian es guapo chat guapisimo y la negrita es guapisima si high school musical actua en coruña o en madrid o en pontebedra o en ferrol que algien me abise porfabor a y soy la hermana de troy bolton adios
Fecha: 2008-09-29 08:38:20

RAUL escribió:
sois geniales¡¡¡¡¡¡¡¡¡¡¡¡¡ las peliculas son increibles sois mis fans
Fecha: 2008-09-29 09:38:12

daniel gonzalezbarra escribió:
me encanta high school musical 1 , 2 y quiero ver la 3 de todas las pelis que he visto estas son las mejores de bustro mejor fan daniel gonzales ibarra
Fecha: 2008-09-29 10:57:28

ANA SORIA escribió:
Fecha: 2008-10-09 13:38:53

eileen rodriguez escribió:
son muy buenos casntantes, actores, me gustan mucho sus peliculas soy su admiradora numero 1 espero q algun dia vengan a panama a veraguas, santiago las palmeras donde vivo yo son muy lindos(as) espero q se contacten con migo byeeeee y q sigan produciendo EXITO byeeeeeeeeeeeee
Fecha: 2008-09-29 19:38:01

litzy escribió:
HIGH SCHOOL MUSICAL me encanta tengo una amiga que se llama Graciela y es mi mejor amiga del mundo.
Fecha: 2008-09-29 21:11:52

Nadya escribió:
gabriela y troy son los dos reeeeeeee lindos y me gusta su pelicula y como amigos deven ser reeeee buenoss
Fecha: 2008-09-24 18:10:32

carmen millan escribió:
high school musical sois los mejores os quiero a ver si venis a gustaria mucho veros.adio wapos muchos la mejor del mundo.
Fecha: 2008-09-25 08:03:47

anonimo escribió:
para mi chad y gabriella son los mejores!! yo nome creo lo de que troy es guapo ni nada porque me parece muy feo en cambio chad y gabriella son los mas guapos y majos aunque taylor tambien me gusta y yo quiero decir que en el pueblo que vivo yo todos estan con gabtiella taylor y sobre todo chad aqui no nos interesa el tonto de troy.arriba chad y gabriella!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!sois los mejores y haceis una buena pareja vesos anonimo
Fecha: 2008-09-25 14:06:15

brian escribió:
es la mejor pelicula que e visto
Fecha: 2008-09-25 16:34:18

makita escribió:
alguien me podria decir ¿como se juega esto? no se porq'pero todavia no puedo jugar
Fecha: 2008-09-26 15:27:05

VALENTINA escribió:
Fecha: 2008-09-26 15:35:42

nerys escribió:
me gusta mucho los personajes de troy bolton ygabriela como zack efron y vaessa hudgens y viene la peli de hsm3
Fecha: 2008-10-06 15:08:43

maria serrano escribió:
hola zac eres el chico mas guapo del mundo dentro de la pantalla y fuera en mi colegio tenemos un club de fans de high school musical.Serias tan de agregar mi msn es por favor te lo dice una que tine toda su habitacion toda de cosas de high school musical.Tamibien se lo digo a vannesa,ahsley,lucas,cobrin y a monique.Por favor os lo dice vuestra fan nº1 del mundo plis .kits.maria
Fecha: 2008-10-03 12:28:36

pamela escribió:
esto esta nitido te amo zac
Fecha: 2008-10-09 17:01:18

karla escribió:
hola,pues yo digo k GABRIELA esta muy...FEA y k Troy dbria ser novio d sharpay. LUCAS ers + wpo k todos T AMO MUXXOO. bye
Fecha: 2008-10-06 16:54:28

ainhoa escribió:
ola me llamo ainhoa i soi de galicia, me encanta high school musical
Fecha: 2008-10-20 12:40:21

elena escribió:
Fecha: 2008-10-07 10:59:29

dana escribió:
Fecha: 2008-10-07 11:44:53

dayana escribió:
me parece muy bien la peli y troe esta buenisimo
Fecha: 2008-10-04 16:32:13

julia tercero lopez y yaiza es mi mejor amiga viva las plays escribió:
Fecha: 2008-10-07 10:51:46

gema escribió:
a mi me gusta mucho high school musical.El personaje qe mas me gusta es vanessa porqe es muy guapa.
Fecha: 2008-10-05 08:44:45

andrea escribió:
que asiosa estoy de ver hsm3 en el punt de alzira jejeje!
Fecha: 2008-10-10 06:03:00

gemminis45 escribió:
troy es el tio mas bueno del mundo sueño con el todas las nochessss ESTA CAÑON
Fecha: 2008-10-07 12:46:37

sara escribió:
A my me gusta por ke los actores son fantasticos q guai
Fecha: 2008-10-10 13:28:56

andres escribió:
ami me gusta high school musical 1y2 no se como sera la tercera parte de su pelicula por ami me gusta a vanesa como canta y quiero ver high school musical3
Fecha: 2008-10-13 20:41:47

florencia escribió:
holis amo high school musical son la fan numero 1 les paso mi email
Fecha: 2008-10-08 22:32:19

GEMA escribió:
Fecha: 2008-10-09 03:21:18

paola escribió:
q guay q es estar ayi ro dando e sa palicula
Fecha: 2008-10-09 07:06:12

anonimo escribió:
qsoy muy fans de todos tengo la toalla el cojin las revistas tengo todo y Troy es muy guapo desearia que me diese un beso en la boca
Fecha: 2008-10-11 08:48:40

anonimo escribió:
qsoy muy fans de todos tengo la toalla el cojin las revistas tengo todo y Troy es muy guapo desearia que me diese un beso en la boca
Fecha: 2008-10-11 08:48:43

kevin escribió:
hola chavos de latinoamérica soy de méxico y tuve la suerte de ir a todos los shows de high scool
Fecha: 2008-10-11 11:06:17

Vanessa escribió:
me gusto la peli, para mi es la mas linda de toa la vida y tuve una suerte de encontrar esta pagina para escribir a los personajes de la peli...bye besotes para todos de high school muscial y pasenla bien haciendo su nueva peli high school musical3 la graduacion :)bye...
Fecha: 2008-10-14 15:26:35

Janire escribió:
Hola Gabriella,Troy,Taylor,Chad,Sarpay y Raian ya tengo la pelicula 1 y 2 de high scool musical. Ya e visto un millon de veces las peliculas y e visto que bailais muy bien.Os mando muchos besos a todos.Hasta otro dia si nos podemos ver.Adios
Fecha: 2008-10-15 11:02:39

vanesa escribió:
te quiero mucho
Fecha: 2008-10-12 18:19:40

ainhoa escribió:
cuando es la pelicula de haig eschoo musical
Fecha: 2008-10-20 12:59:09

kothiiithaxx escribió:
qiero mandarle un saludo a zac , vanessa y hanna montana , sharpay y rayan
Fecha: 2008-10-15 18:46:05

kathy y paula escribió:
me encanta gabriela troy taylor sarpay chad y muchos mas pero mas de todos troy es muy guapooooo
Fecha: 2008-10-22 12:26:58

celia escribió:
meeeeeeeeeee encanta todos de high schooL musical osea q soy una gran fan de todo y tambien una gran fan de todo y todas del disney channel. tengo 8 años y me llamo celia
Fecha: 2008-10-22 12:29:08

lidia escribió:
quiero que Gabriela zac Tailor chat Sharpay y rayan agan un concurso en valencia
Fecha: 2008-10-16 10:42:32

Miriam escribió:
Ola soy Miriam y me encanta bailar y cantar por eso me encanta high school musical. A mi tambien me gusta Zac efron, pero no solo el sino tambien me gustan Ashley, Vanessa, Lucas, Corbin y Monique son mis cantantes y bailarines favoritos además de guapos y simpáticos saben cantar y bailar ¡¡QUE PASADA!! Bueno yo tambien quisiera tener los MSN de todos ellos para poder hablar de la serie y así hacernos amigos; ¿o no? ¿A ustedes no les gustaria hablar con ellos? A mi sí y me encantaría. Chao besitos para todos los de High School Musical bye very kisses.
Fecha: 2008-10-22 14:29:12

selene escribió:
hello¡¡¡¡!!!! zac te amo con toda mi alma & sos muy lindo nene .......
Fecha: 2008-10-16 18:20:54

Lissett y janet escribió:
Hola nos encanta los bailes y canciones de high school musical weno nos vamos.
Fecha: 2008-10-23 06:05:11

mila escribió:
hola soy mila troy esta bueno quiero tu msn
Fecha: 2008-10-17 06:32:03

andrea escribió:
zac eres guapisimo te amo mandame fotos tuyas a mi correo besos andrea
Fecha: 2008-10-17 10:17:10

Liss escribió:
Hola nos encanta los bailes y canciones de high school musical weno nos vamos.
Fecha: 2008-10-23 06:05:25

sofia escribió:
zac i love you
Fecha: 2008-10-17 21:01:17

pauli escribió:
tengo muchas ganas de ver la peli de gigh school musical final de curso. molan los personajes y troy y grabiela hacen buena pareja es todas las pelis
Fecha: 2008-10-21 16:13:18

claudia=p.v. escribió:
me encanta high school musical, deberiais conocer a una de mis mejores amigas, a ella si k le encanta high school musical!!!!
Fecha: 2008-10-18 05:41:33

maryan escribió:
hola sois ls mejores os quiero mucho
Fecha: 2008-10-18 12:13:50

carla escribió:
ola soy carla y hsm son los mejores me encantan sus pelis ah y zac esta para comer selo si o no bueno xao bessst para tds adios
Fecha: 2008-10-20 15:05:15

lilia escribió:
hola yo soy la mejor fans de zac efron y de vanessa hungens ese es nmi sueño conocerlos y hablar en directamente
Fecha: 2008-10-18 21:06:16

lilia escribió:
zac me muero por verte ok
Fecha: 2008-10-18 21:09:22

Elena escribio: escribió:
soy los mejores me han encantado vuestaras dos peliculas y no me voy ha perder la tercera , zac , vanessa , ashley me encantais. xao
Fecha: 2008-10-21 00:08:25

Yicela Villavicencio escribió:
hola ashley tisdale como estas sabias que lo conosi a zac y es un bomon
Fecha: 2008-10-23 11:01:18

vanesa escribió:
me bolbeis loca zac estas para comerte de verdad neniko te amo soy maria y tengo tu edad soy cantante fuy aoperacion triunfo me ice famosa es mi sueño echo realidad os amo mandarme algo a mi email os kiero conocer aver si algun di boy a beros e visto buestra ultima peli fin de curso y me bolbio loca os kiero ablarme aunke sea la k creo buestro grupo pork ella es española como yo os amo y soys lo k mas kiero en esta vida os lo prometo
Fecha: 2008-10-21 04:03:36

cristina buñola escribió:
hola ,soy fan numero uno de high school musical me encanta yo ire aver la peli de high school musical 3 en estreno es la peli que mas me a gustado . que guapos que soys vane y zac
Fecha: 2008-10-19 08:56:41

Gema escribió:
Me encanta hsm y me gustaria ver pronto HSM3 sois los mejores.
Fecha: 2008-10-21 05:37:54

ANA escribió:
Fecha: 2008-10-19 11:20:39

ainhoa aix ferre escribió:
zac eres super guapo y tambien eres muy listo. tambien me encanto mucho HIGH SCHOOL MUSICAL 2
Fecha: 2008-10-21 07:42:17

alexandra escribió:
soy una gran fan de high school musical estoy esperando ir al cine para verla 3 que seguramente va a molar un monton mi personaje favorito es sharpey y del chico troy soy una gran fan como si fuese la numero 1 mola besosss adios fanes que lo paseis muy bien con la nueva peli de high scool musucal bueno que adios que me entretengo mucho besos
Fecha: 2008-10-19 14:04:44

karina liz nei escribió:
aora no echais nada por la tele.y hai veces que las peliculas de los mayores las echais por la tarde o al mediodia, cuando los niños/a estan despiertos y las peliculas de niños/a las haceis cuando los niños/a estan durmiendo. espero que no lo sigai haciendo. gracias
Fecha: 2008-10-19 14:12:36

jose carlos escribió:
hsm is the best
Fecha: 2008-10-23 11:24:36

melania escribió:
buestra 3 peli seguro que esta chulisima ojala la bea jejjeje sois guais
Fecha: 2008-10-21 11:03:10

iReNita escribió:
a mi me encanaria ver hsm 3 pero debirian acer una 4º pelicula una 5º y 6º jaja xaooooo
Fecha: 2008-10-21 11:03:54

pilar super escribió:
Me encanta high school musical y espero que nunca acaben sus peliculas
Fecha: 2008-10-21 11:14:54

mayra escribió:
hola soy may y me gustar ia mucho ser como vanee
Fecha: 2008-10-21 11:23:16

Carla escribió:
ola sy Carla tengo 10 años!!! y yo kisiera k si lees este sms me contestaras por favor y eres mas wapa
Fecha: 2008-10-21 11:47:46

adrian escribió:
!quiero ver high school musical 3! adios amigos
Fecha: 2008-10-21 12:11:43

cathy dice....... escribió:
son los mexores me encantaria ver hsm 3 luegos se ve super buena bexossssss a todos por alla lla xaooooooooooooooooo
Fecha: 2008-10-19 20:23:46

Alvaro escribió:
como conocer a Hanna Montana caraa cara¿?
Fecha: 2008-10-21 13:38:57

lucia escribió:
hola soy lucia y me encantaria trabajar con bosotros mi edad es 10 años ¡¡¡¡buena suerte y adios¿¡¿
Fecha: 2008-10-20 07:26:56

gadea escribió:
high school musical es la mejor pelicula k e visto en mi vida me gustan todos los personajesw pero ami me parece mas guapo troyy chac y de chicas gabrilla y sarpay los adoro a todos y cuando etrenen la pelicula boy a estar la primera de la fila os quiero wualcats
Fecha: 2008-10-21 15:19:05

ROSARIO escribió:
high school musical es lo mejor de los mejores es la pelicula mas chida en mi vida soy su fan numero uno de zac efron y de ashley tisdale
Fecha: 2008-10-23 18:26:25

abril escribió:
me encanta high school tufan
Fecha: 2008-10-22 09:39:57

la mas tonta del mundo escribió:
no me gusta hal school miusic por eso soy la mas tonta del mundo por k segun mi clase es una PASADAAAAAAAAAA
Fecha: 2008-10-27 10:14:07

alvaro escribió:
Fecha: 2008-10-27 10:47:46

Deyra Lizeth escribió:
me encanta high scool musical gabriela y zac son mis mejores actrisesclaro que todos quieren que agan high scool musical pero es su desision esta bien chida ADIOS.
Fecha: 2008-10-24 12:36:55

bertilla escribió:
ola ola jeje no se que decir a si que me gusta muxo high school musical tio ire tienes razon no hay edad pa high school musical dew...=)
Fecha: 2008-10-27 12:47:47

huyt escribió:
hola hola hola sharpay la peli HSM 3 fin de curso
Fecha: 2008-10-25 03:59:19

sara escribió:
yo creo que zac es feisimo en cambio vanessa es guapisima,y espero verles en hsm3
Fecha: 2008-10-25 05:46:49

ANDREA escribió:
Fecha: 2008-10-27 13:09:48

carmen prieto vk escribió:
me encantan todas las pelis y dentro de 3 horas bere la 3 25-10-2008
Fecha: 2008-10-25 08:34:09

Laura escribió:
me encanta high school musical y troy eres super guapo ojala os conozca en persona sois los mejores
Fecha: 2008-10-27 14:40:31

aliciya escribió:
zac eres wapiiiiiiisimo soy tu primera fans bueno y la de vanessa jeje xao besitos para todos wapooooooooooooooooossss un beso : alicia
Fecha: 2008-10-27 15:05:36

mariaaa escribió:
me encantan todas pero la ke mas es la 3 esta xulisima el personaje ke mas me guta es la del piano kelsi.
Fecha: 2008-10-25 09:44:32

farah escribió:
zac efron y y vanessa hudgesn son los mejores y cantas muy bien un beso
Fecha: 2008-10-25 11:13:11

farah escribió:
la verdad si le lees el msnseje keria conocerte a zac efron ke es wapisismo y a vanessa ke tambien es wapisima un beso aaa y tengo 10 años!!!!
Fecha: 2008-10-25 11:15:31

mailyn escribió:
hola soy mailyn y tengo 9 años me encanta hsm chao
Fecha: 2008-10-25 11:56:15

laura escribió:
porque acaballs high scool musical
Fecha: 2008-10-25 13:23:36

karmen-xus escribió:
olaaa kero decir k zac (troy)sta wenisimo y k grabiella y sherpey son las mas wapa y kero conseguir el msn de troy y grabiella y sherpey.ojala es mi sueño os kero a todos muxos.xauuu wapisimos a todos los de high school musical k stos son los mas wapos aunk sois todos.xauuuuu besos os km dejeis de hacer peliculas k stan xuliiiisimas. BESOSSS!!!! KARMEN-XUSSSS!¡!¡! (CARMEN).
Fecha: 2008-10-29 14:59:03

ger escribió:
troy eres guapisimo
Fecha: 2008-10-28 15:15:40

jalimar escribió:
hola soy jalimar quiero que den la pelicula en DVD saludos a todos
Fecha: 2008-10-28 16:30:07

ANA escribió:
Fecha: 2008-10-26 04:56:01

@guzz escribió:
hol a mi me re copo esta idea pero no juge haora voy ajugar y pruevo ay vuelvo? X)
Fecha: 2008-10-29 11:58:29

Emma escribió:
Hola Vanesa todas tus pelis son super guays
Fecha: 2008-10-26 09:09:54

alberto escribió:
me encanta sharpey es muy guapa es la mejor
Fecha: 2008-10-29 14:08:15

karen escribió:
me encantais un monton.sois los mejores!!!!!!
Fecha: 2008-10-26 09:58:49

CAMILA escribió:
Fecha: 2008-10-26 10:23:23

inmilla escribió:
Hola a todos soy de Alosno (Huelva) y amy me escanta esta pely y para my los mejores son ryan y Troy . Besos a todos !!!!!!
Fecha: 2008-10-26 10:32:01

juanma G escribió:
Fecha: 2008-10-26 10:41:36

Ritilla escribió:
Hola soy Ritilla y me gusta mucho la pely y todos los personajes pero el mejor el Troy eso ya se sabe jj.Soy de Alosno (Huelva) y Juanma G e Inmilla son mis mejores amigos jj .
Fecha: 2008-10-26 10:49:14

pepita escribió:
y amy meguta jal escul musical por k es mi preferido y sabes kien es el mas feo zac efro y el mas guapo lucas arriba lucas uuuuuuuuuu zac .
Fecha: 2008-10-26 11:20:25

maria jose escribió:
me gusta la peli porque es bkn
Fecha: 2008-10-26 11:55:54

geraldine escribió:
me encanta la peli por sus canciones y los personejs que mas me ustan son sharpey y gabrielay creo que el mas guapo es troy
Fecha: 2008-10-26 13:48:23

PRIZCE escribió:
Fecha: 2008-10-26 15:01:42

marcela escribió:
zac efroon eres un repapasito me gustas mucho y vane eres una gran actris y eres muy linda
Fecha: 2008-10-27 09:18:39

laura escribió:
troy quero ser tu novia te quiero tas como un tren
Fecha: 2008-10-26 16:36:20

iiRee escribió:
y0 teng0 17 añ0s & me encatan t0das sus peLicuLas..n0 ay edad para high sch00L musiCaL!! 0jaLa n0 sea eL fiinaL & t0d0 teRmine bien un besiit0 ~(LL.
Fecha: 2008-10-27 06:31:56

RAMIRO escribió:
quisiera conseguir todos los messenger de hsm
Fecha: 2008-10-28 17:34:13

ALEJANDRO escribió:
Fecha: 2008-10-29 01:10:56

maria escribió:
Fecha: 2008-11-10 11:44:18

elia escribió:
me gusta mucho sharpey esta muy buena lo ace muy bien i canta super.Para mi es una superestrells a bajo Gabriela arriba Sharpey
Fecha: 2008-11-01 06:00:29

thais escribió:
bueno primeramente q dios les bendiga ha todos los que participan en esta pelicula a gabriela y a troy principalmente, bueno yo voy mañana ha ver high scool musical 3 por qa de verdad si me gusta ver esta pelicula aunque deben agregar mas juegos y todo eso pero eso no importa lo q me importa es que les vaya bien y que gabriela no seas mala con sharpey porfavor por q eso no le agrada a DIOS y te aconsejo q vayas a una iglesia y q seas cabeza y no cola !Q DIOS TE BENDIGA A TODOS! CHAOOOOOOOOOOOOOOOOOOOO
Fecha: 2008-10-30 20:19:41

pauli escribió:
me gusta mucho (highs school musical 1,2y3) son la caña y no te digo son lo mejor porque gabriela y troy cantan como los angeles y que HSM buelban a la pantaya ¡¡adios¡¡
Fecha: 2008-11-04 13:17:53

david el mejor escribió:
Fecha: 2008-11-01 11:57:13

ana la mejor escribió:
Fecha: 2008-11-01 14:06:07

L@ury... escribió:
hola a los chicos de h s m...les keria decir ke me encanta HSM... bueno nos vemos BYE!!!
Fecha: 2008-11-01 18:47:38

*america* escribió:
sharpey es la unica en la peli, mando saludos a zac efran
Fecha: 2008-11-01 20:28:31

VICTORIA escribió:
Fecha: 2008-11-02 09:05:36

laura escribió:
Fecha: 2008-11-05 17:22:56

Fecha: 2008-11-02 14:37:25

troy escribió:
troy me yamo como tu eres el mejor aaaaaaaaaaaaaa ya se me olvida tu novia gabriela es una mamacita!!!!!!!!!!!!!!
Fecha: 2008-11-02 20:29:35

Florencia Sanchez escribió:
hola a todos me llamo florencia y me gusta mucho HIGH SCHOOL MUSICAL!!! ii kiero qee sepan qee soii fanatica d esta pelicula!!! sharpain sos genial igual qee gabriella ii troy!! BESOS A TODOS!!! BYYEEE!!
Fecha: 2008-11-03 08:29:29

marien escribió:
ola me llamo marien y me gustan muxo las pelis de high school musical!!!me encanta sus pelis la 1 la 2 y la 3 la e visto y me a gustado muxo , su musica sus bailes en la 1 peli llore xk me gusto muxo en la 2 tambien y en la 3 tambien!!!!!! me encantaria ke high school musical tenga muxo exito y triunfe mucho en esta peli ke an sacado nueva. todas sus pelis me encantan. mi sueño es ver a todos los personajes de high school musical.UN BESO A TODOS LOS PERSONAJES Y A LOS PRODUCTORES DE HIGH SCHOOL MUSICA.SON GENIALES. K AGAN MUXAS PELIS MAS Y KE TRIUNFEN MUXO EN TODA ESPAÑA EN LONDRES EN REINO UNIDO ETC.ADIOS!!!!!! GOOD BAY!!!!!
Fecha: 2008-11-03 12:08:38

lucia escribió:
ola m llamo lucia y me encanta high schol musical he visto la 1 la 2 y la 3y me gustan mucho
Fecha: 2008-11-06 15:22:28

Manuela escribió:
hola me llamo manuela soy de uruguay san jose me gusta mucho high scool miusic 1 , 2 ,por ahora high 3 no la he bisto cuando la vean segura va a esatar de+ eso sabelo sobretodo lo q mas me gusta de high es zac (troy)esta q se pare y buhe eso es todo lo q tengo para decir jejeje los dejpo espero q respondan bss manu lo quiero high manu__________**//
Fecha: 2008-11-06 17:32:42

vanessa muñoz escribió:
no tengo nada que decir solo que den en la tele mas seguido
Fecha: 2008-11-13 13:44:46

kelly andrea escribió:
me gusta los personajes de haigh school muusical el papasito de zac efron
Fecha: 2008-11-13 21:26:19

Lizzie escribió:
me encanta gabriela
Fecha: 2008-11-18 12:34:26

Laura m escribió:
no es tan wapo el zac efrones mes wapo el corbin bleu i el nick jonas a mi m'agraden mes els nois dels cabells arrissats i els que saben actuar i cantar a l'hora visca el corbin bleu i el nick jonas
Fecha: 2008-11-10 07:30:56

Fecha: 2008-11-07 09:28:46

Paula Andres Giraldez escribió:
Fecha: 2008-11-07 13:27:01

DIANA escribió:
Fecha: 2008-11-13 13:18:44

oriana escribió:
hulazZ YO SOY ORIANA YO TRABAJO EN somos tu y yo ym me facina high scool musil 3 la graduacion yo ya la vi en cines en pelicula y todo mi cuarto es de ustedes en especial a zac efron jejeje y eh visto videos de gabriela ehh cm decirlo con zac en la playa haciando cochita osea y bueno deverian de ponerle algo mas divertido com un fondo de ustedes sus vidas como le van con quien trata en la pelicula quien les cae mal en la pelicula mas cosas pues los dejos xq tengop q ir a grabar en venevision unas bromita bye byee >se le rekiere a todos los de high scool musical
Fecha: 2008-11-12 06:51:07

rocio escribió:
hoLa puesz me gusta mucho mucho la peli
Fecha: 2008-11-08 18:18:15

gisela escribió:
nada q el video no es tan linda es un poc mmuy esa
Fecha: 2008-11-09 09:54:02

jemima escribió:
me encanta Gabriella,Troy,Taylor,Chad,Sarpay y Raian como cantan ustedes la verdad les doy un gran boeso y abraso ay les doy un mms mandenme ps plis para saber si nlo recibieron plis bueno te mando beso zac que eres tan lindo tan bello polis mandame mensaje porfa bay cudate muxo y ya as la pelicula high school musical 4 ya ps para verla plis
Fecha: 2008-11-12 15:27:19

MIGUEL escribió:
me gustan todas sus pelis y me gustaria verlos atodos en persona y sobre todo a gabriela que esta muy bonita...
Fecha: 2008-11-20 16:16:31

laura escribió:
zac sos super divino y tu vanessa tambien eres linda lo ubico que quiero es saludarlos ustedes son lo mejor chao los adoro
Fecha: 2008-11-15 14:43:57

cami escribió:
hola soy camila zac sos un bombon
Fecha: 2008-11-15 16:35:49

denisse escribió:
ola mi yo pienso qee deben poner juegos de gabriella donde la poeden vestir amo a high school musical
Fecha: 2008-11-15 19:53:41

jimena paz escribió:
olaaa qe xon bkn ustedes tengo 10 años i me gusta a zac i a gabriela ella es mui bonita xaitox jimena paz carrasco saldivia
Fecha: 2008-11-16 12:18:53

jimenitax escribió:
olaaaaaaaaa yo digo qe porqe no dan su novela en el tvn y asi los niños qe no tienen cable los podran ver xaoo!!
Fecha: 2008-11-16 12:24:08

sandy escribió:
hola quiero desirles que soy 1000 porciento fan hsm tengo 10 años voy en clases de jazz y siempre ponen canciones de vanessa super cool y super fashion los amo a todos los de hsm y les mando un saludo a todos las chicas bueno me despido chaooooooooooooo
Fecha: 2008-11-17 00:50:54

cristian escribió:
ami me gusta mucho high shool musical2 y tambien tengo el telefono.
Fecha: 2008-11-27 12:30:02

cata escribió:
vanessa estas muy bonita en high shool musical 3 y me encantan las 10 canciones nuevas troy eres lo mejor eres un papacito
Fecha: 2008-11-27 09:35:46

daniela escribió:
hola me encata su juego y siempre que sale una cancion nueva la descargo, canto en ingles super chebre adios bay, bay
Fecha: 2008-11-17 11:36:23

CAMILA escribió:
Fecha: 2008-11-28 11:49:54

paula escribió:
hola digo q hsm deberia de poner mas juegos para divertirnos jaja me encanta hsm jaja sobretodo grabiela y troy mi mesinger es ... y espero q ableis con migo tengo 12 años y soy muy buena adioss
Fecha: 2008-11-27 15:26:01

maria escribió:
me encanta esta pagina
Fecha: 2008-11-17 13:00:25

kristel escribió:
Fecha: 2008-11-17 15:33:35

alejandra escribió:
me encantan todas sus pelis de son super me gustaria conocerlos en persona soy una de sus fans numero 1
Fecha: 2008-11-20 13:27:38

erikka escribió:
esta muy guapisimo zac efron y soy una admiradora especial y creeo que deverian venir a mexico a dar autografos y fotos,nos encantan sus peliculas.
Fecha: 2008-11-21 20:38:32

diana laura escribió:
hola soy diana y aun no puedo jugar nose porque
Fecha: 2008-11-21 22:30:19

lara escribió:
troy es ló+ lo adoro es re londo
Fecha: 2008-11-22 03:36:06

alondra escribió:
yo pienso que debe haber juegos dibertidos de vanesa y zac
Fecha: 2008-11-22 11:39:02

marti escribió:
pongan juegos los amo
Fecha: 2008-11-22 16:34:18

javiera diaz escribió:
mis personajes favoritos son: el zac efron y la vanessa son muy bonitos y los demas tambien los quiero adios chau
Fecha: 2008-11-26 16:36:44

nicole escribió:
hola soy nicole gabriela eres hermosa y quisiera berte yo soy tu de todo el mundo y te amo
Fecha: 2008-11-26 17:01:32

salmasmas escribió:
mirave la verdad high school musical 2 no me guso tanto el 3 me lo vi no lo podian aser más vacano esa vaina tan fea y que todo nuestro esfuero para hacer esta pelicula sera desastre porqueria no sabes quien soy jajajajajajajaj buajaja guagaga mentira me enca________________
Fecha: 2008-11-26 18:08:33

genesis escribió:
Fecha: 2008-11-23 16:46:40

melina escribió:
hola grabriela y troy me encantaron sus peliculas y geacias por hacernos divertir a todo el mundo y a mi
Fecha: 2008-11-24 10:10:49

priscila jacqueline escribió:
hola gabriela yo soy tu fans eres muy bonita ya vi la pelicula de high scool 3 tu y sharppey soy como enemigas tu y troy son novios bueno adios vanessa se despide priscila de 8 años de guadalajara jalisco.
Fecha: 2008-11-24 15:35:10

camila escribió:
hola yo kiero jugar a este jajajajajajaj
Fecha: 2008-11-24 15:44:41

Lucia escribió:
Me encantaria ser como sharpey muy guapa y muy graciosa. Mis personajes favoritos son:Sharpey y Troy
Fecha: 2008-11-26 15:03:11

alba sala montoto escribió:
Fecha: 2008-11-30 04:59:10

ERENDIRA escribió:
pz esta super padre esto tengo 12 años y me encantan estos super juegos y te amo zak afron y a gabriela soy tu mas grande admiradira
Fecha: 2008-11-30 21:55:00

braian escribió:
tengo 9 años soy su fan numero 1
Fecha: 2008-12-03 10:17:26

rocio escribió:
me encanta disney channel es un canal chulicimo,me encanta las seriesque echan bsssssssssssssssss
Fecha: 2008-12-14 10:26:54

cristel escribió:
hola vanessa hola troy como estan los quiero mucho cuando jugamos de high school musical digo yo yo soy vanessa y mi amigo dice que es troy y mi novio dice que es ryany yo me rio porque yo le digo que si yo soy vanessa entoses soy vos aaa si es verda yo le digo tonto como yo llatego 15 años y el 16 año
Fecha: 2008-12-02 13:24:07

angela escribió:
hola zac y vanessa sois los mejores de la peli
Fecha: 2008-12-02 14:06:57

belen escribió:
hay shoolmusical son super bkn xau
Fecha: 2008-12-02 15:16:09

cataXD escribió:
HoLa sOy CaTa SoY sU fAn N°1
Fecha: 2008-12-02 15:32:31

juampi escribió:
holaa!!! soy juan soy de jujuy los quiero mucho a todos y los felisito a troy y gabriela chauuuuuuuuuuuuuuuuuuuuuuuu!!!!!!! juampi
Fecha: 2008-12-05 11:12:06

rocio escribió:
me encanta disney channel es un canal chulicimo,me encanta las seriesque echan bsssssssssssssssss
Fecha: 2008-12-14 10:26:22

adriana escribió:
hola zac y vanessa sois los mejores de la pelicula
Fecha: 2008-12-03 15:19:29

julieta escribió:
holaaaaaaaaa!!!!! como estan??? los felicito a troy y gabriela!!!!!!!!!!!!! por la hermosa pelicula que hacen y a todos tambien me encanta el primer tema cuando se conocen uno al otro les dois un fuerte aplauzo los quiero muchisimooooooooo!!!!!! y sigan asi como estan con la peli de high scooll musical byeeeeee!!!!!!! chauuuuuuuuuuuu!!!!!!! juliiiii!!!!! felicitaciones
Fecha: 2008-12-05 11:06:56

Eleonora escribió:
A mi me gusta mucho troy y gabriela
Fecha: 2008-12-16 07:30:09

David escribió:
No se k le veis a HSM...mi movil es: 606324157 ''kien kiera k me llame''
Fecha: 2008-12-16 09:15:14

esther maria escribió:
hola soy esther maria ami me encantan todos los de high school musical y sobretodo a troy y a gabriela troy estas wenisimo
Fecha: 2008-12-05 12:35:38

anee escribió:
hi my name is anee tengo 13 yers para mi todos son fantasticos , pero trot no se como puedes estar tan bueno
Fecha: 2008-12-05 16:34:56

anee escribió:
hola me llamo anee y todos ustedes son muy buenos actores besosos
Fecha: 2008-12-05 16:35:42

karen y vanessa escribió:
a mi me encanta high school musical a mi prima tambien le gusta quisieramos conocerlos
Fecha: 2008-12-05 20:48:30

angie carolina escribió:
me encanta lo ojos de zac son super lindos son super unicos
Fecha: 2008-12-17 08:29:56

allyson escribió:
hola gabriela como estas soy tu fan y de troy sharpei tambien a mi me encanta su pelicula quisiera conoserlos adoro su pelicula troy tu eres muy guapo y tu gabriela tu eres muy linda tambien tu sharpei eres muy linda tambieny te digo sharpei haces un buen papel me encanta tu papel bueno me boi chaito ok besos los quiero mucho
Fecha: 2008-12-06 15:07:45

cristina escribió:
vanesa y zac con asley son los mejores de la peli
Fecha: 2008-12-17 05:05:42

briguett escribió:
puxa a mi me encanta la pelicula high school musical es k es tan bonito y tan romantico
Fecha: 2008-12-06 16:58:51

rocio escribió:
pos a mi me gusta zack efron es ¡¡¡¡guapisimo!!! y a una amiga mia tambien
Fecha: 2008-12-09 15:20:47

laura escribió:
me encanta high shool musical 2 troy esta guapisimo.
Fecha: 2008-12-15 12:53:32

laura escribió:
sharpay eres total me encanta tu ropa.
Fecha: 2008-12-15 12:57:03

andres escribió:
¿q raro ustedes creen q vallan a sacar hsm4?
Fecha: 2008-12-09 19:35:29

angie rosa castillo escribió:
por favor me puedes conseguir un trabajo de novela o musica pelicula gracias y mi numero es 445-0072
Fecha: 2008-12-10 14:19:50

Ana Rincón Sánchez escribió:
he visto todas las peliculas, me han gustado mucho. Sharpay es muy mala, pero en la 2 Ryan le ayuda a los waicats a ganar el concurso.Bien echo Ryan.Besos Ana
Fecha: 2008-12-19 12:12:34

beatriz escribió:
Fecha: 2008-12-10 16:51:58

mateo escribió:
sharpay eres la mejor chica me enseñas a ser como tu bueno me voy no te olvides de escrimirme un mensajes.besos chauuuuuuuuu.
Fecha: 2008-12-12 15:03:55

paula escribió:
hola a mi me gustan todos pero mis preferidos son zac y vanessa los adoro un bs a todosssssssssss
Fecha: 2008-12-13 09:04:31

alejandra escribió:
a mi me gusta muxo la serie de hanna montana y me gusta muxo disney chanel
Fecha: 2008-12-13 11:09:13

anto escribió:
Fecha: 2008-12-13 12:21:03

andrea escribió:
hola me encanta HIGH SCOOL MUSICAL Gabriella y Sharpay son las mejores y las dos cantan muy bien besos a todos
Fecha: 2008-12-26 14:16:00

scarlet escribió:
hola me llamo scarlet y me parecio bien chevere el juego
Fecha: 2008-12-18 14:53:51

andrea escribió:
hola me encanta HIGH SCOOL MUSICAL Gabriella y Sharpay son las mejores del mundo BESITOS A TODOS
Fecha: 2008-12-26 14:31:18

joseline escribió:
hsm es lo mejor del mundo me facina que salga una inteligente un beisbolista una presumida y todos lo que componen este elenco es fantastico!!!! me facina q no me pierdo ninguna de sus peliculas y la 3 la vi 8 beses en el cine
Fecha: 2008-12-26 13:25:55

karen escribió:
me encanta las peliculas amis amigos tambien la peli mas favorita es la 3 vesitos vai
Fecha: 2008-12-20 09:43:49

Emma de 9 años escribió:
Hola me llamo Emma y quiero que sepais todos los de HSM que vuestras pelis me parecieron tope wais no dejo de intentar buscar todas las pelis para poder verlas. La peli que mas me ha gustado ha sido la 3.
Fecha: 2008-12-19 06:51:53

andrea escribió:
hola me encanta HIGH SCOOL MUSICAL Gabriella y Sharpay son las mejores del mundo BESITOS A TODOS
Fecha: 2008-12-26 14:49:26

Las peliculas de high school musical molan mazo. Troy esta que te cagas de bueno es super mega guapo y Gabriella tambien es super mega guapisima de la muerte. os quiero a los dos,sois guapisimos. Gabriella que suerte tienes por poder besar a Troy esta buenisimo. Ojala yo fuera novia de Troy. Gabriella ¿Troy es tu novio en la vida real? ¿Os habeis casado?
Fecha: 2008-12-23 05:07:20

claudia escribió:
gabriela te felicito por una buena actuacion y yo no creo en la difamacion de los demas....chauuuuuuuuuuuuu cuidate.
Fecha: 2008-12-26 15:15:47

andrea escribió:
zac y vennesa soy vuestra mayor fan tengo mi habitacion llena de posters vuestros
Fecha: 2008-12-20 15:06:42

victor escribió:
hanna montana eres muy guapa me gustaria follar con tigo arggggggggggggggggggggg guapisima besos mua mua mua de victor
Fecha: 2008-12-20 15:22:06

andrea escribió:
hola me encanta HIGH SCOOL MUSICAL Gabriella y Sharpay son las megores y las dos cantan muy bien besos a todos
Fecha: 2008-12-26 14:11:41

diana escribió:
ola soy diana me gustaria conocer a zac efron y a vanesa hugdens porke son tan guapos¡¡ vi ya en un concierto a los jonas brothers y son mas GUAPOS me desmaye y to bueno me voy chao un bss
Fecha: 2008-12-23 08:46:48

diana marcela escribió:
Fecha: 2008-12-20 20:21:57

lorena escribió:
hola soy lorena a que zac y joe son guapos me gustan los dosy de high school musical me gusta vannesa es guapisima mi hermana emma le gusta sharpay y a mi hermana maria taylor adios voy a cenar
Fecha: 2008-12-21 13:03:45

estefanny escribió:
menecanta ver high school musical me gusta banesa y troy y megusta taylor y sarbey cumplo 6 años megusta cansiones de troy y gabriela y megusta ver hanna montana y zak y cody y mikey y miney pucca y moster chauu besos ♥♥ corazones
Fecha: 2008-12-23 12:13:10

josloli escribió:
HSCM es el peor grupo abajo HSCM ariba los jonas brethers jou nik y kevin
Fecha: 2008-12-24 06:59:50

cata escribió:
Fecha: 2008-12-24 10:17:02

alieska escribió:
ola soy alieska nataly me gusta ver hannamontana y hig school musical 2 y la 3 cumplo 12 años mi ermanita cumple 6 años me gusta las kansione de hig school musical 3 y 2 de troy y gr
Fecha: 2008-12-23 12:27:19

ESTRELLITA escribió:
la pelicula de high scool musical 3 fin de curso ya la e visto en el cine pero espero que agan mas pelicula por que todos me an encantado y espero que high scool musical siga para siempre adelante por que son favulosos todo el grupo
Fecha: 2008-12-29 11:58:38

alieska escribió:
ola soy alieska cumplo 12 años y mi ermanita cumple 6 años y megusta ver hig school musical 2 y 3 me gusta las cansiones de hig school musical mi numero de telefono de mi y de mi mama y de mi ermana telefono es 326-40-86 no se olbiden de llamar ya troy y gabriela les quiero mucho chauuuuuuuuu besos corazones ♥♥
Fecha: 2008-12-23 12:43:11

Fecha: 2008-12-23 16:54:59

natasha escribió:
bueno a mi me gusta todo y tambien quiero tener un novio yo tengo 25 años y ya quiero tener un novio bye chau
Fecha: 2008-12-29 16:12:31

zuri escribió:
gavi,zac,asli soy su fan numero 1
Fecha: 2008-12-23 18:20:38

samantha escribió:
me encanta high school musical fantastico¡¡¡¡
Fecha: 2008-12-23 19:38:21

natasha escribió:
bueno a mi me gusta todo y tambien quiero tener un novio yo tengo 25 años y ya quiero tener un novio bye chau
Fecha: 2008-12-29 16:12:42

itziara escribió:
troy estas muy bueno mas bueno que los demas niños que me gustan me gustan carlos aaron y mañana es mi cumpleaños cumplo 14años ya soy muy vieja jajaja me encantan como bailan todos menos chad y tailor gabriela bailas genial besos de vuestra mayor fan numero 1 de todos ustedes .Besos itziara
Fecha: 2008-12-24 05:31:45

LAURA escribió:
Sharpay eres la mejor, Gabriella la mas guapa, Troy el massssssssssssssssssss guapo del mundo, Rayan el mas simpatico, Chad el mas alegre, y Tailor tambien la mas simpatica, soy la fan numero 1 . Besitos
Fecha: 2008-12-24 06:20:30

maria fernanda escribió:
hola ustedes son los mejores me pueden dur todos su mns los amo
Fecha: 2008-12-29 11:05:19

laly escribió:
es una peli genial. y troy esta buenisimo. lo siento vanessa te lo kitare, aunke me caes bien, te kiero troy eres el mejor y el negrito no esta nada mal. vanesa eres mejor ke sharpey en la peily en realidad, shrpey creida. os kiero a todos high school musical besos
Fecha: 2008-12-27 12:03:36

oulaya chentouf escribió:
queridos personajes de hihg school musical sois los mejores.Hos boy a dar un consejo segir asi y estudiar mucho.besos Oulaya.
Fecha: 2008-12-28 10:27:17

vanevero iñiguez escribió:
me encanta high school musical 1 2 3 son las peliculas que mas he visto me encanta y me encanta vanessa hudgens y zac efron pero me encanta vanessa hudgen sus canciones son hermosa en especial say ok soy la fan nomero1 de high school musical y vanessa hugens ah y quiero decir que nuca se junten con camila montalvo por que les va hacer la vida inposible bueno bye
Fecha: 2008-12-28 18:08:07

anna calduch oton escribió:
Fecha: 2008-12-29 06:19:14

BELU escribió:
Fecha: 2008-12-29 08:26:31

cristina escribió:
me encantan todas las peliculas de high scool musical
Fecha: 2008-12-29 08:56:01

grabiela escribió:
se puede ser como grabiela de mayor
Fecha: 2008-12-30 12:54:29

grabiela escribió:
se puede ser como grabiela de mayor
Fecha: 2008-12-30 12:54:32

Carmen escribió:
Holla!Tengo 8 años imedio. Adoro Hsm,la1,2,y3.Espero que salga la 4!Me gusta mucho Gabriella y Troy! De,Carmen
Fecha: 2008-12-30 13:02:27

neni escribió:
sois los mejores del mundo os quiero muxo gabriela,sharpay sois las mejores sarpay me encanta tu personaje en otel dulce otel zac estas muy bueno.
Fecha: 2008-12-30 13:31:55

neni escribió:
sois los mejores del mundo os quiero muxo gabriela,sharpay sois las mejores sarpay me encanta tu personaje en otel dulce otel zac estas muy bueno.
Fecha: 2008-12-30 13:32:33

lisbeth escribió:
hello me llamo lisbidy pero me dicen lisbeth me encantan los personajes de high school musical 2 las peliculas la he visto todas sus musicas etc mi personajes favoritos son gabriela,sharpay,y troy bueno adios besotes..............
Fecha: 2008-12-30 14:42:32

maria coma-cros escribió:
npo me gustan las pelis tan guays porque si!1
Fecha: 2009-01-05 14:07:36

ariel escribió:
mola disneychanel
Fecha: 2008-12-31 08:45:16

yule escribió:
Fecha: 2009-01-07 07:13:29

ana escribió:
zac efron esta cañon y tiene unos musculos esta buenisimo
Fecha: 2009-01-05 15:33:00

ikramitta escribió:
me encanta hiqh school musical y ma como cantan.xD
Fecha: 2009-01-01 04:48:55

blanca escribió:
hola chicos sois los mejores os quiero hacer una pregunta muy inportante porque soys protagonista un beso muy fuerte blanca
Fecha: 2009-01-06 01:54:47

noelia escribió:
zac deja ya a vanessa yo soy mejor soy super guapa y en la habitación tengo muchos posters
Fecha: 2009-01-01 16:10:59

almudena escribió:
vanessa y zac son los mejores de la pelicula de high school musical siempre van guapisimos y por eso y por todo lo ke asen me gusta
Fecha: 2009-01-19 12:03:18

elena escribió:
hello my name is elena I love speak and you
Fecha: 2009-01-06 09:44:25

mireia lopez gadea escribió:
me encanta high scool musical e visto la 1,2 y la 3 la que mas me gusta es grabiela canta muy muy bien.En mi habitacion tengo un postyer gigante de la 3. me encanta HSM
Fecha: 2009-01-03 06:30:19

paloma spinola escribió:
zac efron eres el mas guapo de la pelicula.como te haces ese peinao? me puedes decir tu messenger?y yo te digo el mio el mio es agregame porfavor dime el tuyo que no se te olvide.dime tambien cuantos años tienes. xao
Fecha: 2009-01-03 07:20:05

veronica escribió:
zac eres todo un amor quiciera ser vanessa para tocar tus lindos labios
Fecha: 2009-01-07 13:14:51

miluska escribió:
zac efron es el mas guapo de la peli ,troy me puedes decir tu email porfa yo te voy a decir el mio me agregas me hablas chau
Fecha: 2009-01-03 12:52:41

sandra escribió:
la primera vez que ví high school musical (1)me encanto , cuando ví high school musical (2) flipé en colores (el vestuario era fantastico) y cuando ví high school musical (3) un poco mas y me desmallo (zac estava wapisimo) y gabriella tambien .
Fecha: 2009-01-03 13:10:34

paula escribió:
me gusta mucho las peliculas que aveis hecho lo malo de todo esque solo hicistes 3 podias hacer 14. ¿no?
Fecha: 2009-01-07 05:30:01

michelle escribió:
holA SOY michelle tengo 8 años la que mas me gusta es asly me encanta su comportamiento su pelo y su sonrisa me encanta cantar y bailar de mayor quiero ser como asly me invento asta pasos como ella y canto fenomenal os quuuierro
Fecha: 2009-01-06 13:36:30

imma escribió:
a me high school musical me gusta muelto me gusta a veder loro bailar e cantar io soy imma holaaaaaaaaaaaa
Fecha: 2009-01-27 12:26:24

veronica andrea escribió:
son buenos los juegos y me gusta verlos juntos en la peli de high school musical a zac y vanessa
Fecha: 2009-01-07 13:08:32

imma escribió:
a me high school musical me gusta muelto me gusta a veder loro bailar e cantar io soy imma holaaaaaaaaaaaa